β-CYFLUTHRIN-INDUCED IMPAIRMENT IN NEUROTRANSMITTERS, TESTICULAR FUNCTION AND GENE EXPERISSIONS OF MALE RATS: THE PROTECTIVE ROLE OF OMEGA-3
HTML Full Textβ-CYFLUTHRIN-INDUCED IMPAIRMENT IN NEUROTRANSMITTERS, TESTICULAR FUNCTION AND GENE EXPERISSIONS OF MALE RATS: THE PROTECTIVE ROLE OF OMEGA-3
Heba M. Abdou*1, Nema A. Mohamed 1, Doaa Awad 2 and Ibtehal El-Qazaz 3
Department of Zoology 1, Department of Biochemistry 2, Faculty of Science, Alexandria University, Alexandria, Egypt.
Department of Zoology 3, Faculty of Science, Damanhor University, Alexandria, Egypt.
ABSTRACT: The present study was designed to evaluate the protective effect of omega-3 against β-cyfluthrin (β-cyf)-induced neurotransmitters’ impairment, oxidative damage, testicular toxicity and genotoxicity. Adult male Wistar rats were divided equally into four groups: Group (I): Control, Group (II): β-cyf (5 mg/kg body weight/day), Group (III): omega-3 (400 mg/kg body weight/da y) + β-cyf (5 mg/kg body weight/day), Group (IV): omega-3 (400 mg/kg body weight/day). β-cyf’s treatment for 8 weeks inhibited the activities of AChE, DA, LDH, total ATPase and Na+/K+ATPase. Also, β-cyf resulted in an increase in oxidative stress as indicated by elevations in the levels of MDA and NO while, the levels of TAC, thiol content and TP were decreased in brain and testis. Sperm count, sperm motility and testosterone levels were reduced while, sperm abnormalities, FSH and LH levels were increased in β-cyf-treated group. Also, β-cyf administration led to a significant increase in TNFα, IL-6 and APP mRNA expressions. In addition, β-cyf caused histopathological alterations in brain and testis. The present results showed that omega-3 could improve all the measured parameters. In conclusion, omega-3 could exhibit protective effects against β-cyf induced neurological and testicular damage.
| Keywords: |
β-cyfluthrin, Omega-3, Neurotransmitters, Oxidative stress, Steroidogenesis, Genotoxicity
INTRODUCTION: Pyrethroids are highly active insecticides which account for 30% of insecticides used globally 1. β-cyfluthrin (β-cyf) is a member of type II pyrethroids and is widely used in agricultural and public health and hygiene 2. β-cyf (Cyano-(4-fluoro-3-phenoxyphenil)-methyl-3-(2,2-dichloroethenyl)-2, 2-dimethyl - cyclopropane carboxylate) is the active ingredient of insecticide formulations.
β-cyf is well known as a hepatotoxic, neurotoxic, and teratogenic agent by causing oxidative stress. Its toxicity is exhibited by its metabolites that generate free radicals and in turn causing oxidative stress 3, 4. These free radicals also damage the cell components including proteins, lipids and DNA 5.
Currently, the primary concerns of exposure to pyrethroids are developmental neurotoxicity 6. β-cyf is a neurotoxic agent as it contains an alpha-cyano group which renders them more neurotoxic than their noncyano type I. It induces alterations in nerve membrane, leading to abnormal sodium and potassium ion flow 7. Exposure to insecticide is commonly associated with restriction of spermatogenesis, destruction of seminiferous epithelium, hydrocels leading to infertility 8.
Omega-3 (Polyunsaturated fatty acids) are considered essential, because they are not synthesized by the human body that lack the natural desaturase enzymes Δ-15 and Δ-12. The traditional omega-3 supplements consist of native fish oils or fish, often cod, liver oil. Nowadays the most part of the supplements contain as much as 85% of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) presented as ethyl esters (EE) or triacyglycerols. Omega-3, its members EPA and DHA, is the essential lipid class for synthesis of inflammation mediators and regulators 9, 10.
Therefore, the present study was aimed to investigate the protective role of omega-3 in amilorating the neuro- and testicular impairment induced by β-cyfluthrin in male rats.
MATERIALS AND METHODS:
Chemicals: β-cyfluthrin (Jolicoeur) in liquid form (10%) was purchased from Chema Industries - Nubaria City, Egypt. Gelatin capsules of omega-3 (1000 mg) were obtained from Arab Co. for gelatin and pharmaceutical products of Montana Pharmaceutical.
Experimental animal and treatment: Twenty eight adult male Wistar albino rats (180-200 g) were obtained from Faculty of Medicine, Alexandria University, Egypt. Animals were housed in a stainless steel wire cages placed in a well-ventilated animal house and kept on basal diet and tap water ad libitum. They maintained at 25±1°C with 12 hrs dark and light cycle. The local committee approved the design of the experiments, and the protocol conforms to the guidelines of the National Institutes of Health (NIH).
Animals were randomly divided into four groups as follow:
Group I: Control group: rats of this group were orally received distilled water as vehicle.
Group II: β-cyfluthrin group: rats of this group were orally received β-cyfluthrin at a dose 5 mg/kg body weight/day dissolved in distilled water 7.
Group III: Omega-3 group: rats of this group were orally received omega-3 at a dose 400 mg/kg body weight/day 11.
Group IV: β-cyfluthrin and omega-3 group: rats of this group were pre-treated orally with omega-3 at a dose of 400 mg/kg body weight/day for 10 consecutive days and then in combination with β-cyfluthrin at a dose 5 mg/kg body weight/day (Omega-3 was given to rats 30 min before β-cyfluthrin). Rats were orally administered their respective doses every day for eight weeks.
Blood collection and tissue preparation: At the end of the 8th week of the experimental period, all animals of each group were anaesthetized with diethyl ether and sacrificed. Blood samples were collected from anaesthetized rats in sterile test tubes and placed immediately on ice. Serum was obtained by centrifugation of blood samples at 3000 rpm for 20 min (Hettich zentrifugen, Universal 32 R, Germany) and was stored at -80 ºC for the determination of biochemical parameters.
Parts of the brain tissues were immediately removed and kept at −80 °C till molecular analysis. Another parts of brain and testis were immediately removed and washed using cold chilled saline solution 0.9% then, they were minced and homogenized (10%, w/v) separately, in ice-cold 50 mM potassium phosphate buffer at pH 7.4 in a Pottere Elvehjem type homogenizer. The homogenate was centrifuged at 10,000 rpm for 20 min at 4 ºC, and the resultant supernatants were stored at -80 ºC.
Biochemical parameters:
Brain acetylcholinesterase, dopamine and lactate dehydrogenase estimation:
Acetylcholinesterase (AChE; E.C. 3.1.1.7) 12. Dopamine (DA) level was detected according to the manufacturer's instructions (GenWay Biotech, San Diego, USA) by using Solid phase enzyme-linked immunosorbent assay (ELISA) based on the sandwich principle. The activity of lactate dehydrogenase (LDH; E.C. 1.1.1.27) was assayed kinetically 13 by using commercial kits (Bio Systems S.A Costa Brava 30, Barcelona, Spain). Total ATPase activity (E.C. 3.6.1.3) was assayed using ELISA kit purchased from Immuno way. Na+-K+/ATPase activity (E.C. 3.6.3.9) was estimated using ELISA kit purchased from MyBioSource, USA.
Determination of Malondialdhyde, nitric oxide, total antioxidant capacity and total thiol content in brain and testis tissues: Malondialdehyde (MDA), nitric oxide (NO) and total antioxidant capacity (TAC) kits were purchased from Biodiagnostic Co. Cairo, Egypt. Total thiol content of brain and testis was also carried out 13.
Evaluation of epididymal sperm quality: Epididymal sperm analysis was carried out using a computer assisted semen analysis-Sperm Vision™ CASA System (MiniTUb, Tiefenbach, Germany) with Olympus BX 51 phase microscope (Olympus, Japan) 14.
Determination of testosterone, FSH and LH: The testosterone 15, FSH 16 and LH 17 were assayed using ELISA kits purchased from DRG International, Inc, BIOCODE–HYCEL and Elabscience Co., respectively.
Molecular analysis:
Isolation of total RNA: Total RNA was extracted from brain tissues 18 procedure using GStractTM RNA Isolation Kit II, Guanidinium Thiocyanate Method. Briefly, the tissue was homogenized in BIOZOL; total RNA Extraction Reagent (80-100 mg tissue/ml) and incubated in ice for 15 min. One hundred microliters chloroform was added to the homogenate and mixed by vigorous vortexing three times for 20 s. It was incubated in ice for 15 min then centrifuged at 12,000 rpm for 15 min at 4 ºC. The aqueous phase was transferred into new test tube and the same volume from cold isopropanol was added, mixed and incubated at -20 ºC for 25 min. The mixture was then centrifuged at 12,000 rpm for 10 min at 4 ºC and the aqueous/isopropanol solution was discarded. The pellets were washed three times with ice-cold 75% ethanol solution then were left to dry. The dried pellets were re-suspended in 50-100 μl RNAase free H2O and stored at -80 °C.
Determination of RNA concentration and purity: RNA concentration was determined by measuring the absorbance at 260 nm (RNA solution was diluted 5/495 μl with RNAase free water). The concentration was calculated using the following equation: 1 absorbance unit at 260 nm corresponds to approximate concentration of 40 μg/ml of single-stranded RNA. Quality of RNA preparations were confirmed by calculating 260/280 ratio for detection of protein contamination and by running samples on agarose to confirm that the samples are DNA-free. Pure preparations of RNA have ratios of 1.8–2.0.
Reverse-transcriptase poly chain reaction (RT-PCR): Alteration in the steady state mRNA levels of genes relevant to neuroinflammation pathogenesis in rats is determined using reverse-transcriptase PCR analysis. Using one-step RT-PCR (RT/PCR Master Mix Gold Beads, BIORON) reaction, the cDNA was synthesized and used for amplification of the target gene(s). Briefly, total RNA (1–3 μg) and random primer (3 μM) mixture were denatured at 70 °C for 5 min and placed on ice. The incubated mixture was added to the RT/PCR Gold mix that contains all the components necessary for cDNA synthesis and amplification in one tube. The cDNA synthesis reaction was performed at 42 ºC for 60 min then 5 min at 94 °C for RTase inactivation. The primers then subjected to PCR cycles, each cycle consisting of denaturation, annealing, and extension. Annealing temperature and time was optimized for each primer/template combination. The expression of the neuroinflammatory, marker TNF-α expression was investigated by using the following primers sets. (Table 1)
TABLE 1: THE PRIMER SEQUENCES OF TARGET GENE IN EXPECTED PCR PRODUCTS FOR RT-PCR
| Primers sequence and condition | Reference | |
| -β-actin
F: 5'-GGCATCCTGACCCTGAAGTA-3' R: 5'-GCC GAT AGT GAT GAC CTG ACC-3' 94˚C for 45s, 60˚C for 45s, 72˚C for 45s Number of cycles: 35 |
19 | |
| -TNF-α
F :5′CTCTTCTCCTTCCTGATCGTGGCA3' R:5' GAAAGCATGATCCGGGACGTGGA3' 94˚C for 30sec, 53˚C for 30sec,72˚C for 1 min Number of cycles: 35 |
20 |
|
Agarose Gel Electrophoresis of the amplified RT-PCR products, visualization and documentation: Products of RT-PCR were separated on agarose gel 21. Mixture of total volume of 10 μl was prepared by mixing 7 μl of the RT-PCR product and 3 μl of the sample loading dye and electrophoresed on 1.5 % agarose gel (1.5 g/100 ml 0.5x TBE) containing 10 μg/ml ethidium bromide (EtBr) dye then visualized and documented using Chemi Doc-It®2 Imager then analyzed with Vision Works LS Acquisition and Analysis Software for determinations of relative bands intensity.
Quantitative RT-PCR assay (qRT-PCR): Quantitative RT-PCR was used to measure the mRNA expression levels of IL-6 and APP genes. cDNA was synthesized by High-Capacity cDNA Reverse Transcription Kit according to the manufacture protocol. The primer for IL-6 (5'-CGAAAGTCAACTCCATCTGCC-3' and 5'-GGCAACTGGCTGGAAGTCTCT-3') 22. The primer for APP gene (5′-TGCTGAAGATGTGGG TTCGA-3 and 5′-GACAATCACGGTTGCTAT GACAA-3′) 23. The primers for β-actin; 5’- CCGACAGGATGCAGAAGG-3’- and 3’-GGAGTACTTGCGCTCAGGAG.5’. IL-6 and APP were normalized to β-actin, fold difference calculated by 2−ΔΔCT 24.
Histological section preparation: Brain and testis specimens were obtained from rats, and immediately fixed in 10 % formalin and then treated with conventional grade of alcohol and xylol, embedded in paraffin and sectioned at 4-6 µm thickness. The sections were stained with Haematoxylin and Eosin (H&E) stain for studying the histopathological changes 25.
Statistical analysis: Data have been expressed as mean±SE Statistical analysis of data was performed using SPSS computer software package version 22 (Chicago, IL, USA). Data were analyzed by ANOVA and means were compared with post hoc multiple comparison test. A value of P<0.05 was considered statistically significant.
RESULTS AND DISCUSSION:
Effect of β-cyfluthrin, omega-3 and their combination on AChE, DA, LDH, total ATPase and Na+ /K+ ATPase in brain of male rats: Pyrethroids can easily cross the blood-brain barrier and reach the central nervous system (CNS) leading to neurotoxicity 26. Acetylcholinesterase (AChE) is a vital cholinesterase enzyme present in the neuromuscular junctions and cholinergic synapses in the CNS. AChE is considered as a key enzyme in detecting the neurotoxicity 27. The significant (P<0.05) reduction in AChE activity in β-cyf - treated group (Table 2) indicated that β-cyf was known to block the catalytic site of AChE 28. Moreover, cyf affects voltage sensitive sodium channels, voltage-sensitive calcium channels and alters the release of neurotransmitters 29.
In the current data, co-administration of omega-3 with β-cyf significantly (P<0.05) improved the inhibition in AChE activity (Table 2). This result came accordance with others 30 who investigated that administration of omega-3 fatty acids alone and with lithium and aripiprazole revealed an elevation in the activity of AChE in mice brain. This may be due to the ability of omega-3 to decrease the lipid peroxidation which will manipulate a significant role in the stabilization of AChE activity in the brain. Also, it was reported that PUFAs are compounds that play an important role in cell signaling, enzymatic regulation and may also interact with the cholinergic system showing a protective effect 31.
On the basis of the present results, it might be hypothesized that the significant (P<0.05) lower in dopamine (DA) content (Table 2), could be due to either inhibition of biosynthesis of DA, or decrease in tyrosine hydroxylase (TH) and/or decrease in aromatic L-amino-acid decarboxylase synthesis as observed after exposure to the pyrethroid deltamethrin 4, 32. Thus, β-cyf toxicity might also be due to the release of unstable cyanohydrins. Cyanohydrins are decomposed to cyanides and aldehydes, which in turn could act as a source of free radicals 33. This oxidative stress effect would be another explanation to the decrease of the serotonin (5-HT) and DA levels by β-cyfluthrin as observed in the present study.
Omega-3 pre- and in combination treatment with β-cyfluthrin caused a significant (P<0.05) increase in the activities of brain DA (Table 2). Among the omega-3 PUFAs, docosahexaenoic acid DHA is the most important omega-3 with physiological significance for brain function. Omega-3 dietary deficiency affects the dopaminergic, serotoninergic and glutamatergic systems 34. As a component of membrane phospholipids, it is documented that the percentage of omega-3 influences the physicochemical properties of the membrane and accordingly affect the function of a variety of membrane-bound proteins, including dopaminergic, GABAergic, and cholinergic receptors 35. Dietary intake of omega-3, both absolute and relative to omega-6 status, may contribute to regulation of brain dopaminergic functioning in humans 36.
Table 2 showed a significant (P<0.05) decline in the brain LDH activity suggesting a decrease in the glycolytic process due to the lower metabolic rate as a result of pyrethroid exposure 37. Pretreatment of β-cyf-intoxicated rats with omega-3 was able to significantly improve the reduction of brain LDH (P<0.05). This process can be restricted pharmacologically at different levels with agents that scavenge reactive oxygen metabolites, block their generation or promote endogenous antioxidant capabilities 38. The protective effect of omega-3 against leakage of LDH may be due to the presence of docosahexaenoic acid (DHA) that protect the normal cellular architecture through its incorporation into the phospholipids of cell membranes 39.
Also, Table 2 revealed a significant (P<0.05) decline in the brain total ATPase and Na+/K+ ATPase with β-cyf. This is may be attributed to disturbed mitochondrial energetic system due to the movement of β-cyf molecules within the mitochondria, after its access through the meninges causing a decrease in total ATPase 27. Moreover, toxicants can alter Na+/K+ ATPase activity by disrupting the energy producing metabolic pathway or interacts directly with enzymes. Inactivation of Na+/K+ ATPase leads to partial membrane depolarization allowing excessive Ca2+ entry inside neurons with resultant toxic events like excitotoxicity 40.
In this context, the present data indicated that omega-3 fatty acids in combination with β-cyf significantly (P<0.05) increased total ATPase and Na+/K+ ATPase in brain tissue (Table 2) similar to previous results 41. The protective effect of omega-3 may be attributed to a direct protection of the enzyme molecule by modification of the lipid microenvironment surrounding the Na+/K+ ATPase molecule 42.
TABLE 2: EFFECT OF β-CYFLUTHRIN, OMEGA-3 AND THEIR COMBINATION ON AChE, LDH, DA, TOTAL ATPase AND Na+/K+ ATPase OF MALE RATS
|
Parameters |
Experimental groups | |||
| Control | β-cyfluthrin | Omega-3 | β-cyfluthrin+omega-3 | |
| AChE (U/mg protein) | 171.00±1.345b | 61.85±0.857d | 178.43±2.202a | 111.86±1.121c |
| DA (ng/g tissue) | 189.14±1.335b | 91.28±1.847d | 201.71±1.643a | 159.14±1.183c |
| LDH (U/mg protein) | 210.57±1.192b | 89.14±0.986d | 218.00±0.899a | 140.29±0.969c |
| Total ATPase (U/mg protein) | 57.68±0.378a | 28.12±0.270c | 58.53±0.384a | 45.55±0.392b |
| Na+/K+ ATPase (pg/mg protein) | 32.15±0.340a | 12.44±0.281c | 32.71±0.498a | 24.22±0.214b |
Values are expressed as means±S.E, n=7 for each treatment group.
Mean values within a row not sharing a common superscript letter (a, b, c and d) were significantly different P˂0.05.
Effect of β-cyfluthrin, omega-3 and their combination on the oxidative stress markers: MDA, NO, TAC, total thiol content and total protein (TP) levels in brain and testis of male rats: β-cyf administration exihibeted significant (P<0.05) increase in MDA and NO levels in brain and testis tissues (Table 3). Similar results were obtained by 43, 44 who reported elevation in the levels of MDA and NO after exposure to mixture of type II pyrethroid. The increase in MDA induced by the pyrethroid could be as a result of the generation of ROS that attacked the unsaturated
lipids, thereby causing the generation of lipid peroxides leading to alteration of membrane permeability and cell function. Pyrethroids indirectly generate various ROS such as superoxide radical and hydroxyl radical, and reactive nitrogen species (RNS) like peroxynitrite and nitric oxide 40. Moreover, Table 3 manifested significant (P<0.05) reduction in the total antioxidant capacity (TAC), total thiol and total protein (TP) content in brain and testis of β-cyf- treated group. The decline in the total thiol content may be due to excessive free radical generation, which might attack the thiol group of cysteine residues and polyunsaturated fatty acids of biological membranes 45. Additionally, the accumulation of H2O2 in response to lipid peroxidation leads to a decreased in intracellular GSH and antioxidant enzyme activities 46. Also, the reduction in total protein contents may be attributed to the inhibition of protein synthesis and low cell survival due to defective antioxidant enzyme 47.
Omega-3 treatment in combination with β-cyf significantly (P<0.05) improved the oxidant and antioxidant markers in the brain and testis tissues (Table 3). Similarly, it was reported that omega-3 fatty acids improved the oxidative status of tissues which was confirmed by reduction in the MDA, NO level and elevation in GSH levels. In addition, EPA as a member of omega-3 essential fatty acid may cause stabilization of membrane structure, decrease ROS generation and hence lipid peroxidation 48.
Furthermore, omega-3 is a source of naturally available antioxidant, might make the neural tissues less susceptible to lipid peroxidation leading to its beneficial effects 49. Likewise, it was deduced that omega-3 fatty acids may be useful in the prevention and treatment of methotrexate-induced testicular damage that may be due to its antioxidant properties 50.
TABLE 3: EFFECT OF β-CYFLUTHRIN, OMEGA-3 AND THEIR COMBINATION ON MDA, NO, TAC AND TP LEVELS IN BRAIN AND TESTIS TISSUES OF MALE RATS
|
Parameters |
Experimental groups | |||
| Control | β-cyfluthrin | Omega-3 | β-cyfluthrin+omega-3 | |
| Brain MDA (nmol/g tissue) | 13.12±0.165c | 72.14±0.675a | 12.13±0.165c | 31.53±0.208b |
| NO (nmol/g tissue) | 8.31±0.104c | 25.53±0.240a | 8.42±0.153c | 13.12±0.207b |
| TAC (mM/g tissue) | 65.42±0.350b | 16.91±0.236d | 75.74±0.385a | 48.90±0.441c |
| Thiol content (mM/g tissue) | 51.25±0.356a | 17.50±0.317c | 51.32±0.260a | 32.41±0.404b |
| TP (mg/g tissue ) | 117.00±0.816b | 92.50±0.645d | 127.57±0.649a | 109.00±0.816c |
| Testis MDA (nmol/g tissue) | 12.12±0.132c | 60.42±0.545a | 11.31±0.194c | 23.01±0.277b |
| NO (nmol/g tissue) | 7.31±0.081c | 28.41±0.363a | 7.28±0.085c | 14.14±0.210b |
| TAC (mM/g tissue) | 88.34±0.313a | 20.62±0.215c | 87.58±0.625a | 57.21±0.532b |
| Total thiol (mM/g tissue) | 46.75±0.322a | 19.94±0.254c | 46.68±0.291a | 32.72±0.305b |
| TP (mg/g tissue) | 138.57±0.649b | 115.71±0.680d | 142.00±0.816a | 131.57±0.649c |
Values are expressed as means ±S.E, n=7 for each treatment group.
Mean values within a row not sharing a common super script letter (a, b, c, d) were significantly different P˂0.05
Effect of β-cyfluthrin, omega-3 and their combination on sperm count, sperm motility, sperm abnormalities, testosterone, FSH and LH of male rats: β-cyf exhibited significant (P<0.05) decline in sperm count, sperm motility and significant elevation in sperm abnormalities along with a significant (P<0.05) decrease in testosterone level (Table 4). This decline was attributed to either direct effect of toxicant on androgen biosynthesis pathway in testis or its effect on hypothalamus pituitary gland which might have indirectly affected the testis and sexual function 47. It was also suggested that pyrethroid insecticides may cause mitochondrial membrane impairment in Leydig cells and disrupt testosterone biosynthesis by diminishing the delivery of cholesterol into the mitochondria and decreasing the conversion of cholesterol to pregnenolone in the cells resulting in reducing subsequent testosterone production 51. Hence, the reduced testosterone might be responsible for the decreased sperm counts and
motility and also morphological abnormality of testis. It is hypothesized that the decrease in serum testosterone concentrations suppressed spermatogenesis 52. Besides, β-cyf-treated group showed a significant (P<0.05) increase in FSH and LH (Table 4). The increase in FSH secretion may be principally due to a feedback signal from the damaged seminiferous tubules. Under such situation, the Sertoli cells are found to produce less inhibin B, and then FSH released from the pituitary is increased significantly due to a negative feedback action 53.
Fortunately, omega-3 administration alone or in combination with β-cyf resulted in a significant (P<0.05) amelioration of the disturbances in the sex hormone levels as well as the sperm quality (Table 4). As concerned that feeding fish oil improved all semen characteristics including sperm motility, progressive motility and concentration. This is mainly attributed to the high concentration of PUFAs in fish oil that can be incorporated in the sperm lipids, and cause alterations in the fluidity and flexibility of the sperm membrane 54. There is an evidence that feeding PUFAs can also affect the biosynthetic pathways involved in steroidogenesis, which have multiple roles in the regulation of reproductive function. Moreover, the presence of oleic acid, monounsaturated fatty acids (MUFAs) also lowers the susceptibility of the test is to lipid peroxidation 55. Another reason may be acceptable to give a reliable explanation that omega-3 have a powerful initiation effect on acetylcholine which is a neurotransmitter regulating sexual desire, so stimulation of this neurotransmitter has a positive effect on cognitive functioning, especially memory and attention, and also increase semen volume 56.
TABLE 4: EFFECT OF β-CYFLUTHRIN, OMEGA-3 AND THEIR COMBINATION ON SPERM COUNT, SPERM MOTILITY, SPERM ABNORMALITIES, TESTOSTERONE, FSH AND LH OF MALE RATS
|
Parameters |
Experimental groups | |||
| Control | β-cyfluthrin | Omega-3 | β-cyfluthrin+omega-3 | |
| Sperm count (million/ml) | 98.42±0.649b | 17.42±0.751d | 104.00±0.816a | 62.00±0.534c |
| Sperm motility (%) | 87.71±0.680b | 19.00±0.534d | 92.71±0.680a | 76.42±0.480c |
| Sperm abnormalities (%) | 10.28±0.420c | 69.14±0.911a | 8.28±0.420d | 26.28±0.680b |
| Testosterone (ng/ml) | 7.03±0.056b | 1.09±0.069d | 8.01±0.044a | 4.91±0.050c |
| FSH (ng/ml) | 2.05±0.095c | 6.34±0.057a | 1.34±0.064d | 3.30±0.081b |
| LH (mlU/ml) | 1.05±0.040c | 3.70±0.058a | 0.52±0.021d | 1.61±0.066b |
Values are expressed as means ±S.E, n=7 for each treatment group.
Mean values within a row not sharing a common superscript letter (a, b, c and d) were significantly different P˂0.05.
Effects of β-cyfluthrin, omega-3 and their combination on the brain TNF-α, IL-6 and APP mRNA expressions of male rats: The current results revealed significant elevations (P<0.05) in TNF-α, IL-6 and APP gene expressions in β-cyf group compared to the control group (Fig. 1 and Table 5). Similarly, it was reported that β-cyf caused the up-regulation of interleukin-6 receptor (IL-6R) and tumor necrosis factor receptor super family (TNFRSF10A) genes accompanied with brain inflammation 57.
The NO pathway is involved in the regulation of IL-6 expression in human. At its early stage, it may accelerate the process by stimulating the synthesis of pro-inflammatory cytokines 58. The modulation of cytokine production by monocytes and macrophages depends on INF-γ, which stimulates TNFα synthesis. Furthermore, oxidative stress as free radicals generated by pyrethroids is a paramount player in the induction of pro-inflammatory cytokines that stimulate IL-12, INF-γ and TNFα release 59. ROS are major activators of the NF-ĸB transcription factor involved in innate immune or inflammation responses. Activation of NF-ĸB upregulates the expression of many inflammation-related genes, including; TNF-α, IL-6, IL-8 and vascular endothelial growth factor 60. Furthermore, it was reported that cypermethrin stimulated a typical pro amyloidogenic processing
of APP through sequential activation of β-secretase (BACE) and PS, elevating both isoforms of Aβ 61. The amyloid hypothesis postulates a proteolytic cleavage of APP by BACE to release C-terminal fragment (CTF-β) that is then cleaved by gamma (γ)-secretase to generate Aβ1-42 and less amyloidogenic, Aβ1-40 62. Otherwise, administration of omega-3 alone showed insignificant (P˃0.05) increase in TNF-α (Fig. 1), while, IL-6 and APP gene expressions were insignificantly (P˃0.05) decreased compared to the control group.
Co-addition of omega-3 with β-cyfluthrin significantly (P<0.05) reduced TNF-α, IL-6 and APP gene expressions compared to β-cyf group (Fig. 1 and Table 5). Omega-3 fatty acid supplements can affect cytokine synthesis and can modulate inflammation-induced transcription of TNF-α by inhibition of NF-kB 63. This could be due to omega-3 derived lipid mediators, the resolvins and protectins, which have been shown to be potent anti-inflammatory mediators 64. EPA exerts anti-inflammatory effects through a group of pro-resolving mediators, E-series resolvins, which are derived from EPA by cycloxygenase (COX1) and 5-lipoxygenase (5-LOX) 65.
Previous studies have established that APP processing depends on the local membrane environment, whereas can be altered by manipulating the membrane lipid composition. Since fatty acids modulate membrane organization and functions, they may affect APP processing. In addition, DHA has been shown to increase membrane fluidity and PUFAs play a central role in the normal development and functioning of brain 66. DHA decreased the amount of vascular Aβ deposition and reduced Aβ burden in aged Alzheimer mouse model. In Alzheimer disease mouse model, DHA modulated APP processing by decreasing both α- and β-APP C terminal fragment products and full-length APP 67.

FIG. 1: BRAIN TNFα RELATIVE EXPRESSION IN DIFFERENT EXPERIMENTAL GROUPS (CHANGE CALCULATED IN REFERENCE TO CONTROL
TABLE 5: EFFECT OF β-CYFLUTHRIN, OMEGA-3 AND THEIR COMBINATION ON THE BRAIN IL-6 AND APP mRNA EXPRESSION OF MALE RATS (FOLD CHANGE CALCULATED IN REFERENCE TO CONTROL
|
Parameters |
Experimental groups | |||
| Control | β-cyfluthrin | Omega-3 | β-cyfluthrin +omega-3 | |
| IL-6 | 1.00±0.00c | 4.20±0.56a | 0.85±0.07c | 1.95±0.07b |
| APP | 1.00±0.00c | 3.09±0.15a | 0.98±0.01c | 2.1 ±0.26b |
Values are expressed as means ± SD, n=7 for each treatment group.
Mean values within a row not sharing a common superscript letter (a, b, c) were significantly different P˂0.05.
Histopathological analysis: Histopathological examination of brain sections through cerebral cortex of control and omega-3 groups (Figs. 2 A & C) showed normal histoarchitecture of cerebral cortex tissues; normal pyramidal and granular cells. However, sections in cerebral cortex of β-cyf-treated group exhibited loss of normal structure, neuronal degeneration, encephalomelacia with plaque, presence of cytoplasmic vacuolization, congested blood vessels with edema and neurofibrillary tangles (Figs. 2 B1 & B2) compared to those of control rats.
Cypermethrin induced histopathological alterations; perinuclear cytoplasmic vacuoles in neurons and mild degenerative changes of nerve fibers with congestion of blood vessels 68. This may be due to the intense oxidative stress motivated by cypermethrin which can lead to lipid peroxidation and neurotoxic effect accompanied with inhibition of AChE activity and impairment of neural conductivity in the central and peripheral nervous system. Further, the histopathological alterations were markedly reduced in omega-3 plus β-cyf-treated group manifested more or less normal neurons with few pyknotic nuclei and residual fine vacuolations compared to those of β-cyf-treated group (Fig. 2 D). These observations were coincidence with previous results which indicated that omega-3 supplementation exerts a neuroprotective effect against hyperoxic brain injury in the developing brain 69.
The cellular mechanisms implied the neuroprotective effect of DHA have been identified as free radical scavenger via regulation of gene expression involved in diverse pathways such as cell signaling, division, growth and apoptosis. DHA is the precursor of neuroprotectin D1, which is a lipid mediator demonstrated to protect neurons and retinal cells from oxidative stress-induced apoptosis 70.
FIG. 2: LIGHT MICROGRAPH OF THE BRAIN SECTIONS IN MALE RAT CEREBRAL CORTEX: (A) control rat, normal histo-architecture; normal pyramidal cells (black arrow), normal granular cells(blue arrow) & normal blood vessel(blue dotted arrow). (B1 & B2): Sections of β-cyf –treated rats, showing pericellular edema (black head arrow), dilatation of blood capillary with congestion (green arrow), neurofibrillary tangle(black dotted arrow), pyknotic nuclei (blue dotted arrow), encephalomalacia with plaque formation (green circle), neuronal degeneration&cytoplasmic vaculation (black square) and more glial cells (yellow arrow). (C): Section of the cerebral cortex of rat treated with omega 3-treated group showing, normal histo-architecture with normal histology of the pyramidal cells & granular cells (black arrow). (D): Section of the cerebral cortex of rat treated with omega + 3β-cyf –treated rats, showing slightly restores of the pyramidal cells (black arrow) to near normal structure with residual fine vacuolations (green arrow) and glail cells (yellow arrow)" H&E, X 400".
Light microscopic evaluation of testicular tissue from the control and omega-3 groups showed the normal histology of the testis with complete stages of spermatogenesis and high concentration of sperms in the lumen of the seminiferous tubules (Fig. 3 A & C). While, the testis of the β-cyf group depicted degeneration and atrophy of seminiferous tubules, incomplete spermatogenic cycles, a few numbers of sperms in the lumen and Leydig cells atrophy (Fig. 3 B). These changes may be in the same line with the others who stated that deltamethrin might induce lipid peroxidation and decline in testosterone hormone, since testosterone is required for the attachment of different generations of germ cells in seminiferous tubules.
Therefore, minimal level of testosterone might have led to detachment of germ cells from seminiferous epithelium leading to germ cell apoptosis and reproductive toxicity 51. Treatment with omega-3 plus β-cyf revealed partial improvement of testis architecture, degenerative changes in the germinal cells and sperm numbers (Fig. 3 D). Pretreatment of omega-3 significantly alleviated the abnormalities caused by doxorubicin and largely counteracted the unfavorable effects and preserved the integrity of spermatogenic structures 71.

FIG. 3: LIGHT MICROGRAPH OF THE TESTIS SECTIONS IN MALE RATS: (A) control group, the normal histo - architecture of seminiferous tubules and Leydig cell (L), the different stages of spermatogenesis: spermatogonia (SG), primary spermatocyte (1ry S), secondary spermatocyte (2nd S), spermatids and lumen filled with spermatozoa. (B): β-Cyf –treated group, showing seminiferous tubules lost its shape and appeared with irregular outline with pyknotic nuclei, vacuolations (black arrow) and hemorrhage (yellow arrow). Interstitial tissues showed hemorrhage and enlargement (black dotted arrow). (C) omega3-treated group, showing the normal structure of seminiferous tubules and Leydig cells (L) with regular spermatogenic cycle. Lumen was full of spermatozoa. (D) Omega 3+ β-Cyf –treated group showing slightly improved architecture of semniferous tubules. More or less normal distribution of the spermatogenic cells. "H&E, X 400".
CONCLUSION: In conclusion, omega-3 could exhibit protective effects against β-cyf-induced neurological and testicular damage.
CONFLICT OF INTEREST: The authors declare no conflict of interest.
ACKNOWLEDGEMENTS: The authors are thankful to the histopathological lab at the High Institute of Public Health, Alexandria University, Egypt. Also, grateful to molecular lab at Department of Biochemistry, Faculty of Science, Alexandria University, Alexandria, Egypt.
REFERENCES:
- Prasanthi K and Rajini PS. Fenvalerate-induced oxidative damage in rat tissues and its attenuation by dietary sesame oil. Food and chemical toxicology 2005; 43(2): 299-306.
- European Food Safety Authority (EFSA). Reasoned opinion on the modification of the existing MRL for cyfluthrin in artichokes1. European Food Safety Authority EFSA Journal 2013; 11:10-3448.
- Soni I, Syed F, Bhatnagar P and Mathur R. Perinatal toxicity of cyfluthrin in mice: developmental and behavioral effects. Human and Experimental Toxicology 2011; 30:1096-1105.
- Rodríguez J, Ares I, Castellano V, Martínez M, Martínez-Larrañaga MR, Anadón A and Martínez MA. Effects of exposure to pyrethroid cyfluthrin on serotonin and dopamine levels in brain regions of male rats. Environmental Research 2016; 146: 388–394.
- Persson UM, Henders S and Cederber C. A method for calculating a land‐use change carbon footprint (LUC‐CFP) for agricultural commodities–applications to Brazilian beef and soy. Indonesian palm oil. Global change biology 2014; 20 (11): 3482-3491.
- Baltazara MT, Dinis-Oliveira RJ, Bastosa ML, Aristidis M, Tsatsakise, Duarte JA and Carvalhoa F. Pesticides exposure as etiological factors of Parkinson’s disease and other neurodegenerative diseases- A mechanistic approach. Toxicology Letters 2014; 230: 85–103.
- Rajawat NK, Soni I, Mathur P and Gupta D. Cyfluthrin-induced toxicity on testes of Swiss albino mice. International Journal of Current Microbiology and Applied Sciences 2014; 3: 334-43.
- Shalaby MA, El Zorba HY and Ziada RM. Reproductive toxicity of methomyl insecticide in male rats and protective effect of folic acid. Food and Chemical Toxicology 2010; 48: 3221–3226.
- Bhangle S and Kolasinski SLA. Fish oil in rheumatic diseases. Rheumatic Diseases Clinics 2011; 37: 77–84.
- Chaurasiaa SP, Bhandaria K, Sharma A and Dalaib AK. A Review on Lipase Catalysed Synthesis of DHA Rich Glyceride from Fish Oils. International Journal of Research and Scientific Innovation 2016; 3: 9-19.
- Zararsız I, Kuş I, Davarcı M, Kuş MA and Kaman D. Mustafa Sarsılmaz. The protective effects of omega-3 fatty acids on rat testicular tissue. Dicle Medical Journal 2011; 38: 382-386.
- Magnotti RA, Eberly JP, Quarm DE and Mcconnell RS. Measurement of acetylcholinesterase in erythrocytes in the field. Clinical chemistry 1987; 33(10): 1731-1735.
- Sedlak J and Lindsay RH. Estimation of total, protein bound and non-protein bound sulfhydryl groups in tissues with Ellman’s reagent. Analytical Biochemistry 1968; 25:192–205.
- Krause W. Computer-assisted semen analysis systems: comparison with routine evaluation and prognostic value in male fertility and assisted reproduction. Human Reproduction 1995; 10 (1): 60-66.
- Sakuma Y. Gonadal steroid action and brain sex differentiation in the rat. Journal of neuroendocrinology 2009; 21(4): 410-414.
- Kjeld JM, Kuku SF, Harsoulis P, Fraser TR, Puah CM and Joplin GF. Infusions of hFSH and hLH in normal men. Acta endocrinologica 1976: 81(1): 234-242.
- Teerds KJ, Closset J, Rommerts FFG, De Rooij DG, Stocco DM, Colenbrander B and Hennen G. Effects of pure FSH and LH preparations on the number and function of Leydig cells in immature hypophysectomized rats. Journal of Endocrinology 1989; 120 (1): 97-NP.
- Chomczynski P and Sacchi N. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nature protocols 2006; 1(2): 581-585.
- Zaky A, Mohammad B, Moftah M, Kandeel KM and Bassiouny AR. Apurinic/apyrimidinic endonuclease 1 is a key modulator of aluminum-induced neuro inflammation. BMC neuroscience 2013; 14(1): 26.
- Chiu SC and Yang NS. Inhibition of tumor necrosis factor-α through selective blockade of pre-mRNA splicing by shikonin. Molecular pharmacology 2007; 71 (6):1640-1645.
- Robyt JF and White BJ. Biochemical techniques: theory and practice (Vol. 2). Chicago USA: Waveland Press 1990.
- Berti R, Williams AJ, Moffett JR, Hale SL, Velarde LC, Elliott PJ and Tortella FC. Quantitative Real-Time RT-PCR Analysis of Inflammatory Gene Expression Associated with Ischemia-Reperfusion Brain Injury. Journal of Cerebral Blood Flow & Metabolism 2002; 22(9): 1068-1079.
- Liu DP, Schmidt C, Billings T and Davisson MT. Quantitative PCR genotyping assay for the Ts65Dn mouse model of Down syndrome. Biotechniques 2003; 35:1170-1179.
- Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCTMethods 2001; 25(4): 402-408.
- Drury RAB and Wallington EA. Carleton’s Histological Technique (5th ed.) Oxford University Press, Oxford New York Toronto 1980; 188–189, 237–240, 290–291.
- Singh VK. Liver lipid profile of rattus norvegicus (Berkenhout) after short and long duration oral exposure to fenvalerate. Indian Journal of Biological Studies Research 2012; 2: 24-33.
- Singh AK, Saxena PN and Sharma HN. Stress induced by beta-cyfluthrin, a type-2 pyrethroid, on brain biochemistry of Albino rat (Rattus norvegicus). Biology and Medicine 2009; 1(2): 74-86.
- Rajawat NK, Soni I and Mathur R. Neurobehavioral Alterations Induced by Cyfluthrin in Male Swiss Albino Mice. Bulletin of Environment, Pharmacology and Life Sciences 2015; 4: 119-127.
- Guvenc D, Aksoy A, Gacar A, Atmac E, Dasa K and Guvencb T. Evaluation of changes in monoamine levels and apoptosis induced by cyfluthrin in rats. Toxicology Research 2014; 3: 331–340.
- Arunagiri P and Balamurugan E. Omega-3 fatty acids combined with aripiprazole and lithium modulates activity of mitochondrial enzymes and acetylcholinesterase in methylphenidate-induced animal model of mania. Pharma Nutrition 2016; 1-25.
- Zugno AI, Chipindo H, Canever L, Budni J, de Castro AA, de Oliveira MB and Mastella GA. Omega-3 fatty acids prevent the ketamine-induced increase in acetylcholinesterase activity in an animal model of schizophrenia. Life sciences 2015; 121: 65-69.
- Liu GP and Shi N. The inhibitory effects of deltamethrin on dopamine bio- synthesis in rat PC12 cells. Toxicology Letters 2006; 161: 195–199.
- El-Demerdash FM. Lambda-cyhalothrin-induced changes in oxidative stress biomarkers in rabbit erythrocytes and alleviation effect of some antioxidants. Toxicology in vitro 2007; 21(3): 392-397.
- Moreira JD, Knorr L, Thomazi AP, Simão F, Battú C, Oses JP and Perry ML. Dietary omega-3 fatty acids attenuate cellular damage after a hippocampal ischemic insult in adult rats. The Journal of nutritional biochemistry 2010; 21: 351-356.
- El-Ansary AK, Al-Daihan SK and El-Gezeery AR. On the protective effect of omega-3 against propionic acid-induced neurotoxicity in rat pups. Lipids in health and disease 2011; 10: 1-
- Sublette ME, Galfalvy HC, Hibbeln JR, Keilp JG, Malone KM, Oquendo MA and Mann JJ. Polyunsaturated fatty acid associations with dopaminergic indices in major depressive disorder. The International Journal of Neuropsychopharmacology 2014; 17: 383-391.
- Fetoui H, Garoui EM, Makni-ayadi F and Zeghal N. Oxidative stress induced by lambda-cyhalothrin (LTC) in rat erythrocytes and brain: attenuation by vitamin C. Environmental Toxicology and Pharmacology 2008; 26(2): 225-231.
- Attia AM and Nasr H. Dimethoate-induced changes in biochemical parameters of experimental rat serum and its neutralization by black seed (Nigella sativa L.) oil. Slovak Journal of Animal Science (Slovak Republic) 2009; 42: 87-94.
- Abhilash S, Vineetha RC, Binu P, Arathi P and Harikumaran NR. Evaluation of the cardioprotective effect of docosahexaenoic acid against arsenic trioxide induced toxicity in H9c2 cardiomyocytes by preliminary dose standardization assays. International Journal of Advanced Research in Biological Science 2016; 3: 235-242.
- Ali ZY. Neurotoxic Effect of Lambda-Cyhalothrin, a synthetic pyrethroid pesticide: involvement of oxidative stress and protective role of antioxidant. Mixture New York Science Journal 2012; 5: 93-103.
- Mézešová L, Jendruchová-Javorková V, Vlkovičová J, Okruhlicová LU, Frimmel K, Navarová J and Vrbjar N. Supplementation with n-3 polyunsaturated fatty acids to lipopolysaccharide-induced rats improved inflammation and functional properties of renal Na, K-ATPase. Nutrition research 2013; 33: 772-779.
- Kumosani TA and Moselhy SS. Modulatory effect of cod-liver oil on Na+-K+ ATPase in rats’ brain. Human & experimental toxicology 2011; 30: 267-274.
- Sharma P, Singh R and Jan M. Dose-dependent effect of deltamethrin in testis, liver, and Kidney of wistar rats. Toxicology international 2014; 21(2): 131-139
- Romero A, Ares I, Ramos E, Castellano V, Martínez M, Martínez-Larrañaga MR and Martínez MA. Evidence for dose-additive effects of a type II pyrethroid mixture. In vitro assessment. Environmental research 2015; 138: 58-66.
- Raina R, Verma PK, Pankaj NK and Prawez S. Induction of oxidative stress and lipid peroxidation in rats chronically exposed to cypermethrin through dermal application. Journal of veterinary science 2009; 10: 257-259.
- Fetoui H, Makni M, Garoui EM and Zeghal N. Toxic effects of lambda-cyhalothrin, a synthetic pyrethroid pesticide, on the rat kidney: involvement of oxidative stress and protective role of ascorbic acid. Experimental and Toxicologic Pathology 2010; 62: 593-599.
- Sharma P, Huq AU and Singh R. Cypermethrin induced reproductive toxicity in male Wistar rats: Protective role of Tribulus terrestris. Journal of Environmental Biology 2013; 34: 857-862.
- Karapehlivan M, Ogun M, Kaya I, Ozen H, Deveci HA and Karaman M. Protective effect of omega-3 fatty acid against mercury chloride intoxication in mice. Journal of Trace Elements in Medicine and Biology 2014; 28: 94-99.
- Yadav S, Mitha KV, Shenoy MT, Mayannavar S and Ganaraja B. Beneficial effect of Omega-3 polyunsaturated fatty acids on neurosensorial impairments and oxidative status in Streptozotocin induced diabetic rats. Indian Journal of Physiol Pharmacology 2014; 58: 346-353.
- Kumar C, Igbaria A, D'autreaux B, Planson AG, Junot C, Godat E and Toledano MB. Glutathione revisited: a vital function in iron metabolism and ancillary role in thiol‐redox control. The EMBO journal 2011; 30(10): 2044-2056.
- Desai KR, Moid N, Patel PB and Highland HN. Evaluation of deltamethrin induced reproductive toxicity in male Swiss Albino mice. Asian Pacific Journal of Reproduction 2016; 5(1): 24-30.
- Ahmad L, Khan A, Khan MZ, Hussain I, Mahmood F, Sleemi MK and Abdullah I. Toxico-pathological effects of cypermethrin upon male reproductive system in rabbits. Pesticide biochemistry and physiology 2012; 103: 194-201.
- Li YF, Chen PAN, Hu JX, Jing LI and Xu LC. Effects of cypermethrin on male reproductive system in adult rats. Biomedical and Environmental Sciences 2013; 26: 201-208.
- Jafaroghli M, Abdi-Benemar H, Zamiri MJ, Khalili B, Farshad A and Shadparvar AA. Effects of dietary n-3 fatty acids and vitamin C on semen characteristics, lipid composition of sperm and blood metabolites in fat-tailed Moghani rams. Animal reproduction science 2014; 147: 17-24.
- Elelaimy IA, Elfiky SA, Hassan AM, Ibrahim HM and Elsayad RI. Genotoxicity of anticancer drug Azathioprine (Imuran): role of Omega-3 oil as protective agent. Journal of Applied Pharmaceutical Science 2012; 2: 14-23.
- Mohammad‐Zadeh LF, Moses L and Gwaltney‐Brant SM. Serotonin: a review. Journal of veterinary pharmacology and therapeutics 2008; 31:187-199.
- Mense SM, Sengupta A, Lan C, Zhou M, Bentsman G, Volsky DJ and Zhang L. The common insecticides cyfluthrin and chlorpyrifos alter the expression of a subset of genes with diverse functions in primary human astrocytes. Toxicological Sciences 2006; 93: 125-135.
- Siednienko J, Nowak J, Moynagh PN and Gorczyca WA. Nitric oxide affects IL-6 expression in human peripheral blood mononuclear cells involving cGMP-dependent modulation of NF-κB activity. Cytokine 2011; 54: 282-288.
- Hussein MM and Ahmed MM. The Th1/Th2 paradigm in lambda cyhalothrin-induced spleen toxicity: The role of thymoquinone. Environmental toxicology and pharmacology 2016; 41:14-21.
- Tabrez S, Priyadarshini M, Priyamvada S, Khan MS, Arivarasu NA and Zaidi SK. Gene–environment interactions in heavy metal and pesticide carcinogenesis. Mutation Research/Genetic Toxicology and Environmental Mutagenesis 2014; 760: 1-9.
- Kuperstein I, Broersen K, Benilova I, Rozenski J, Jonckheere W, Debulpaep M and Braeken D. Neurotoxicity of Alzheimer's disease Aβ peptides is induced by small changes in the Aβ42 to Aβ40 ratio. The EMBO journal 2010; 29: 3408-3420.
- Maurya SK, Mishra J, Abbas S and Bandyopadhyay S. Cypermethrin Stimulates GSK3β-Dependent Aβ and p-tau Proteins and Cognitive Loss in Young Rats: Reduced HB-EGF Signaling and Downstream Neuroinflammation as Critical Regulators. Molecular neurobiology 2015; 1-15.
- Lotrich FE, Sears B and McNamara RK. Elevated ratio of arachidonic acid to long-chain omega-3 fatty acids predicts depression development following interferon-alpha treatment: relationship with interleukin-6. Brain, behavior, and immunity 2013; 31: 48-53.
- Schmöcker C, Weylandt KH, Kahlke L, Wang J, Lobeck H, Tiegs G and Kang Omega‐3 fatty acids alleviate chemically induced acute hepatitis by suppression of cytokines. Hepatology 2007; 45: 864-869.
- Song C, Shieh CH, Wu YS, Kalueff A, Gaikwad S and Su KP. The role of omega-3 polyunsaturated fatty acids eicosapentaenoic and docosahexaenoic acids in the treatment of major depression and Alzheimer's disease: Acting separately or synergistically? Progress in lipid research 2016; 62: 41-54.
- Schuchardt JP, Huss M, Stauss-Grabo M and Hahn A. Significance of long chain polyunsaturated fatty acids (PUFAs) for the development and behavior of children. European Journal of Pediatrics 2010; 169: 149-164.
- Yang X, Sheng W, Sun GY and Lee JCM. Effects of fatty acid unsaturation numbers on membrane fluidity and α-secretase-dependent amyloid precursor protein processing. Neurochemistry international 2011; 58: 321-329.
- Hussien HM, Abdou HM and Yousef MI. Cypermethrin induced damage in genomic DNA and histopathological changes in brain and haematotoxicity in rats: The protective effect of sesame oil. Brain research bulletin 2013; 92: 76-83.
- Tuzun F, Kumral A, Ozbal S, Dilek M, Tugyan K, Duman N and Ozkan H. Maternal prenatal omega-3 fatty acid supplementation attenuates hyperoxia-induced apoptosis in the developing rat brain. International Journal of Developmental Neuroscience 2012; 30(4): 315-323.
- Le HD, Meisel JA, de Meijer VE, Gura KM and Puder M. The essentiality of arachidonic acid and docosahexaenoic acid? Prostaglandins Leukot. Essential Fatty Acids 2009; 81 (2-3): 165-170.
- Uygur R, Aktas C, Tulubas F, Uygur E, Kanter M, Erboga M and Ozen OA. Protective effects of fish omega‐3 fatty acids on doxorubicin‐induced testicular apoptosis and oxidative damage in rats. Andrologia 2014; 46(8): 917-926.
How to cite this article:
Abdou HM, Mohamed NA, Awad D and El-Qazaz I: β-cyfluthrin-induced impairment in neurotransmitters, testicular function and gene experissions of male rats: the protective role of omega-3. Int J Pharm Sci Res 2017; 8(7): 2819-31. doi: 10.13040/IJPSR.0975-8232.8(7).2819-31.
All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
10
2819-2831
1466
2260
English
IJPSR
Heba M. Abdou*, Nema A. Mohamed, Doaa Awad and Ibtehal El-Qazaz
Department of Zoology, Faculty of Science, Alexandria University, Alexandria, Egypt.
dr.heba_abdou3000@yahoo.com
24 December, 2016
10 February, 2017
17 February, 2017
10.13040/IJPSR.0975-8232.8(7).2819-31
01 July, 2017










