A NATURAL COUMESTAN WEDELOLACTONE TARGETS INFLAMMATORY CYTOKINES TO INITIATE APOPTOSIS IN HUMAN CERVICAL CANCER CELLS
HTML Full TextA NATURAL COUMESTAN WEDELOLACTONE TARGETS INFLAMMATORY CYTOKINES TO INITIATE APOPTOSIS IN HUMAN CERVICAL CANCER CELLS
R. Gloria Jemmi Christobel, Shyam Sundar Jaganathan, M. P. Abirami, P. Rasappan and S. Shila *
Department of Biochemistry, VRR Institute of Biomedical Science (Affiliated to University of Madras), Chennai - 600056, Tamil Nadu, India.
ABSTRACT: Objective: Wedelolactone is a naturally (WDL) occurring coumestan of phytoestrogen category that possess anticancer and anti-inflammatory property. In this study, the anti-inflammatory effect of WDL on human cervical cancer cells (HeLa) and initiation of apoptosis mechanism were investigated. Methods: MTT assay and Trypan blue assay were demonstrated to detect the inhibitory effects of WDL on cell proliferation. The mRNA expression of IL-1β, TNFα, IL-6, TGFβ, and NFκB were detected by RT PCR. Western blotting was performed to detect the expression of apoptosis-associated proteins; cleaved caspase-3, cleaved PARP, Bcl-2, and Bax. Results: WDL significantly inhibited the growth and proliferation of HeLa cells in a concentration dependent manner with the IC50 of 10µM. mRNA expression of inflammatory cytokines and NFκB was significantly reduced in WDL treated groups. Moreover, WDL promoted the apoptosis of HeLa cells dose-dependently by down-regulating Bcl-2 and up-regulating cleaved caspase-3, cleaved PARP, and Bax. Conclusion: Collectively, WDL exerted anti-inflammatory effect through the suppression of NF-kB activation, IL-1β, TNFα, IL-6 and promoted apoptosis in HeLa cells. Thus, use of WDL, especially through its anti-inflammatory effect, may have future applications in treating human cancers by sensitizing cancer cells to conventional cancer therapies.
| Keywords: |
Wedelolactone, Inflammation, Cytokines, Anti-inflammatory, Apoptosis
INTRODUCTION: Cervical cancers are the most common malignancies among the gynecological oncology. They pose an exclusive threat to treat and cause morbidity. Especially inflammation exerted by HPV (Human papillomavirus) leads to cervicitis that can progress into cervical cancer 1. Unregulated chronic inflammation seems to play a compelling role that leads to the pathogenesis of various malignant tumors such as cervical, ovarian, hepatic and esophageal cancers 2. Inflammation plays essentially an important role in governing cervix pathology and viral infection, such as HPV sensitivity establishing tumor environment 3.
Biochemical, epidemiological, immunological and genetic studies have proved the link between inflammation and malignancy development. Infiltrated immune cells along with its cytokines, chemokines, and growth factors at inflammatory sites lead to cervical cancer. Dysregulated cytokine secretion increases excessive cell growth, transformation into malignancy and its survival 4. Once the tumor initiation stage is established it creates excessive inflammation, which in turn tends to facilitate tumor progression 5.
NF-κB, the key switch mediates crosstalk between inflammation and cancer at various levels. Constitutive activation of NFκB piles up proinflammatory cytokines and establish pro-tumorigenic environment, enhancing the expression of antiapoptotic genes 6. This contributes to the cell survival mechanism by combating the physiological stress that induced the inflammatory response.
NFκB persuades the cytokines that regulate the immune response such as TNFα, IL-1β, IL-6 and TGFβ 7. These inflammatory signals, in turn, induce phosphorylation and proteosomal degradation of IKB by IKKB. This paves way for NFκB nuclear translocation where it activates the genes for transcription. These genes include some of the cytokines IL-1β, TNF and antiapoptotic genes such as Bcl 8. This feed-forward activation amplifies the inflammatory response together with tumorigenic environment. At the tumor site unregulated inflammation intensifies the proliferation rate and angiogenesis and also increases the mortality rate 9. Thus, the need for anti-inflammatory drug of natural origin with less toxic effect in the treatment of cervical cancer is of prime importance.
Wedelolactone a coumestan, derived from Ecliptaprostrata and Wedeliachinensis is a natural drug involved in anti-cancer activity. It has been shown to inhibit NFκB because of its potent anti-inflammatory properties. Many studies have described the in-vitro and in-vivo anticancer properties of Wedelolactone in prostate, breast, hepatocellular and pituitary cancers 10, 11, 12, 13. WDL is a multi-targeted compound and possesses inhibitory effect on multiple kinases. A study by Benes et al., 14 emphasized the proapoptotic role of WDL on breast cancer cells by inhibiting topoisomerase IIα activity. The most important documentation is that WDL is a potent anti-inflammatory drug 15. NFκB is the major pathway involved in immune cell activation in response to inflammation mediators such as TNFα and interleukins during the tumor initiation stage. Suppression of this pathway by WDL underlies the main mechanism of its inhibitory effect on chronic inflammation thereby hindering the tumorigenic environment and enhancing the chemotherapeutic response of cancer cells.
Apoptosis a stringently regulated process is a programmed cell death that initiates cell death via activation of various molecules. The induction of apoptosis in tumor cells exerts a promising way of cancer therapy 16. Apoptosis is mediated by caspases which fall under cysteine protease family. Cytochrome C release from mitochondria is promoted by pro-apoptotic proteins such as Bax, Bad, Bak, and inhibited by anti-apoptotic proteins such as Bcl, Bcl-xL 17. Cytochrome C release activates Caspase 3, which further activates PARP that executes nuclear apoptosis 18. According to Mlynska et al., 19 inflammation at the tumor site results in excess inflammatory cytokine production that ends up in abundant NFκB activation thereby preventing apoptosis of tumor cells. Descending down the expression of inflammatory cytokines by anti-inflammatory drugs might direct the tumor cells towards apoptosis and might improve the conventional chemotherapy regimen.
To the best of our knowledge, this is the first time study about the anti-inflammatory role of WDL in cervical cancer cells. Thus, the objective of this work was to ascertain the effect WDL on inflammatory cytokines IL-1β, IL-6, TGFβ and TNF-? mRNA expression in human cervical cancer cell line HeLa and to correlate these results with the gene expression of NF-?B. We also evaluated the apoptosis-related gene expression and cytotoxic effect of WDL in HeLa cell lines in-vitro. The current work aimed to provide an initial insight into the molecular mechanisms by which WDL could confer anti-cancer activity in HeLa cells. We explored that anti-inflammatory effect of WDL could be the possible mechanism adapted by HeLa cells to undergo apoptotic cell death.
MATERIALS AND METHODS:
Cell Culture and Reagents: HeLa cells obtained from National Centre for Cell Science (Pune, India) were maintained and grown in a humidified incubator at 37 °C with 5% CO2. Cells were grown as a monolayer in plastic tissue culture flasks in Dulbecco’s Modified Eagles Medium (DMEM) (GIBCO, Grand Island, New York, USA). The media was supplemented with 10% fetal bovine serum (FBS) (GIBCO, Grand Island, New York, USA) and antibiotics (Penicillin 50 IU/mL, Streptomycin 3.5 mg/mL and Gentamycin 2.5 mg/mL) (GIBCO, Grand Island, New York, USA). Wedelolactone (WDL) was purchased from Sigma–Aldrich (St. Louis, MO, USA). All reagents were dissolved in Dimethyl sulphoxide.
Cell Viability Assay:
MTT Assay: HeLa cells were seeded in 96-well plates at a density of 5 × 103 cells/well in 200 mL DMEM containing 10% FBS and incubated overnight. Non-adherent cells were removed by gentle washing after 24 h. Then cells were replaced with serum-free medium with varying concentrations of wedelolactone (0–25 µM). A negative control containing serum-free medium with DMSO was also evaluated. After 72 h of treatment, the plates were incubated with 20 mL 3-(4,5-dimethylthiazol-2- yl)-2,5-diphenyltetrazolium bromide (MTT) solutions (5 mg/mL) for 3 h at 37 °C. The formazan was dissolved in 150 mL/well Dimethyl sulfoxide (DMSO) and the absorbance was detected at 590 nm using microplate reader (Bio-Rad, USA). Cell viability was expressed as a percentage of untreated cells, which served as the negative control group and was designated as 100% 20. The results were expressed as a percentage of the negative control. The median inhibitory concentration (IC50) (defined as the drug concentration at which cell growth was inhibited by 50%) was assessed from the dose-response curves.
Trypan Blue Assay: Cell viability was determined by the Trypan blue dye exclusion assay; this dye excluded living cells and only penetrated the cell membrane of dead cells. HeLa cells were treated with wedelolactone (1–25 µM) for 72 h. Attached cells were then trypsinized and combined with Trypan blue reagent, and viable cells were counted by placing the plate on a hemocytometer. The percentage of viable cells was calculated. Results are representative of experiments carried out in triplicate.
RNA Extraction and cDNA Synthesis: Total RNA was isolated from cells using TRIzol reagent (Invitrogen) and quantified in BioPhotometer (Eppendorf, Milan, Italy). For the first-strand cDNA synthesis, 1 µg of total RNA per sample was used, and the reaction was performed with IScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA). Polymerase chain reaction (PCR) amplifications were performed as follows: 35 cycles for IL-1β (94 ºC for 30 s, 6 5ºC for 60 s, and 72 ºC for 60 s), 40 cycles of IL6 (94 ºC for 60 s, 60 ºC for 60 s, and 68 ºC for 120 s), NFkB 40 cycles of (94 ºC for 60 s, 60 ºC for 60 s, and 68 ºC for 120 s) 35 cycles for TGF-β (94 ºC for 30 s, 62 ºC for 30 s, and 72 ºC for 60 s), 40 cycles for TNF-α (94 ºC for 60 s, 60 ºC for 60 s, and 68 ºC for 120 s), and 30 cycles for β actin (94 ºC for 35 s, 64 ºC for 45 s, and 72 ºC for 1 min). Then PCR product 10 μl was electrophoresed in 2% agarose gel and analyzed in gel doc XRS plus (Bio-Rad, USA). The densitometric analyses were carried out with image lab software (Bio-Rad, USA). The expression of each target gene was normalized with internal control. All reactions were performed in duplicate.
TABLE 1: OLIGONUCLEOTIDES FOR REAL-TIME PCR
| TGF-β | TAGACCCTTTCTCCTCCAGGAGACG | GCTGGGGGTCTCCCGGCAAAAGGT |
| TNF-α | TCAGATCATCTTCTCGAACC | CAGATAGATGGGCTCATACC |
| IL-1β | AATCTGTACCTGTCCTGCGTGTT | TGGGTAATTTTTGGGATCTACACTCT |
| IL6 | GGTACATCCTCGACGGCATCT | GTGCCTCTTTGCTGCTTTCAC |
| NFkB | GAAGGAATCGTACCGGGAACA | CTCAGAGGGCCTTGTGACAGTAA |
| β -actin | TCACCCACACTGTGCCCATCTACGA | CAGCGGAACCGCTCATTGCCAATGG |
Western Blotting: The cells were seeded in 6 well plates at a density of 5 ×104 cells/well in 3 mL of DMEM containing 10% FBS overnight. Non-adherent cells were removed by gentle washing after 24 h. Cells were then treated with different doses of wedelolactone to analyze the expression levels of Bcl, Bax, Caspase 3 and PARP. After 48 h of treatment, cells were lysed by the addition of cold RIPA buffer [150 mMNaCl, 50 mMTris HCl, 0.1% SDS, 1% Triton X-100, 1 mM PMSF, 2 mMNaF, β-glycerophosphate and 2 mM EDTA, and fresh protease inhibitor cocktail (Cat No. P8340, Sigma Aldrich)] and cell lysate was centrifuged at 14,000 rpm at 4 °C for 20 min. The supernatant was harvested and analyzed for protein content using BCA method (Cat No. 23227, Pierce, USA). Protein was denatured in sample buffer, then separated on 10% SDS-PAGE and transferred to nitrocellulose membranes (semidry trans-blot system). The blots were blocked overnight at room temperature with Tris-Buffered Saline (TBS, 50 mM Tris-HCl, pH 7.5, 150 mM NaCl) containing 4% bovine serum albumin. The blots were washed three times with TBST (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.02% Tween 20) and incubated with specific primary antibodies (1:1000 dilutions) at 4 °C overnight. The blots were incubated for 1 h at room temperature with secondary antibodies (1:5000 dilutions), and detected by ECL detection reagent. To ensure that equal amounts of sample protein were applied for electrophoresis, β -actin was used as an internal control. Denistometric analysis was done using ImageJ software.
Statistical Data: Data were represented as Mean ± Standard error of the mean (SEM). Statistical significance was analyzed using Anova and Dunnett’s multiple comparison test between the groups, using Graphpad Prism 7.0 software package. P<0.05 was considered to be statistically significant; all the experiments were done in triplicates.
RESULTS:
Cell Viability Assays:
MTT: To establish the impact of WDL on the survival of HeLa cells, cells were treated with 0.01-25 μm WDL, and after that cell viability was examined by MTT assay. As shown in Fig. 1A, cell viability was reduced after treating with 8µM WDL compared to the control. After 48 h, WDL showed high inhibition of cell population growth in a dose-dependent manner with IC50 value of 10 µM.
Trypan Blue Assay: Cell viability was further confirmed by Trypan blue exclusion assay. As shown in Fig. 1B WDL markedly decreased the viability of HeLa cells in a dose-dependent manner. It clearly exhibited a 50% reduction in cell viability at IC50 value of 10 µM Fig. 1B.
mRNA Expression Profiling –RT PCR: Using RT-PCR inflammatory cytokine specific mRNAs were detected in HeLa cells. Cytokine specific bands of TNFα, IL-1β, TGF-β, and IL-6 and NFκB transcripts were detected in untreated and compared with WDL dose-dependent treated cells. Our data showed a significant increase in the level of NFκB and cytokine mRNA expression in control.
At the same time decreased expression of NF-κB, TNFα, IL-1β and IL-6 were observed in WDL treated groups Fig. 2 very little difference in the TGF-β mRNA expression observed in WDL treated cells.
FIG: 1. EFFECT OF WEDELOLACTONE ON VIABILITY OF HeLa CELLS. CELLS WERE TREATED WITH DIFFERENT CONCENTRATIONS OF WDL (0-25µM) FOR 48 h AND ANALYZED USING 1A) MTT ASSAY 1B) TRYPAN BLUE ASSAY. Data are mean ± SD of triplicate determinations.
FIG. 2: EFFECT OF WDL ON INFLAMMATORY CYTOKINES, NF-κB mRNA EXPRESSION. Triplicates of each treatment group were used in each independent experiment. Results were expressed as the Mean ± SD.*p<0.05, **p<0.01, compared with control.
Immunoblot Analysis for Protein Expression: As shown in Fig. 3, the pro-apoptotic protein Bax was found to be elevated in WDL treated cells, whereas the expression of antiapoptotic protein Bcl-2 was repressed after 48 h of treatment with WDL. Our results also exhibited an increase in the protein expression of Cleaved Caspase 3 and Cleaved PARP in WDL treated cells compared to control.
FIG. 3: HeLa CELLS WERE TREATED WITH DIFFERENT CONCENTRATIONS OF WDL (8µM, 10µM, 12µM) FOR 48 h. CELL LYSATES WERE ANALYZED BY WESTERN BLOT FOR APOPTOSIS-RELATED PROTEIN EXPRESSION: Bcl-2, BAX, CLEAVED CASPASE-3, AND CLEAVED PARP. Results were expressed as the Mean ± SD.*p<0.05, **p<0.01, compared with control.
DISCUSSION: Despite the existence of conventional chemotherapy for cervical cancer, poor clinical outcomes in cervical cancer patients were observed 21. Inflammation at the tumor site repels towards apoptosis blocking the application of chemotherapeutic agents 22. Increased production of proinflammatory cytokines promotes the condition from chronic inflammation to tumor. It has been documented that after the tumor development the continual production of inflammatory cytokines initiates signaling pathways such as NFκB that regulate the transcription of target genes involved in cellular proliferation and survival 23. Eliminating inflammation after tumor development may lead to better strategies for cervical cancer therapy 24. Drugs of natural origin that inhibit IL-1Β, TNFα, IL-6, and TGFβ production may prove to be useful in treating cervical cancers as adjuvants in combination with more traditional chemo-therapeutic drugs. WDL is a natural drug that holds promising anti-inflammatory effect 25. Its role against the inflammatory cytokines and NFκB in cervical cancer remains undefined. This in-vitro study is an attempt to reveal the dose-dependent anti-inflammatory effect of WDL on HeLa cells.
MTT is a mitochondrial activity-based assay that is used to analyze in-vitro drug efficacy at varying concentrations. The amount of formazon produced is comparable to the number of living cells that exist in the culture. Cell viability decreased with an increased dose of WDL treatment Fig. 1A. Our data are in line with previous studies 26 that indicated the cytotoxic effect of WDL derivative on breast, endometrial and ovarian cancer cell lines. Similarly cell viability assay using Trypan blue which is based on cytolysis also exhibited reduced viable cells in WDL treated compared to untreated control. WDL efficiently reduced the cell viability in a dose-dependent manner Fig. 1B.
Among various inflammatory cytokines TNFα, IL-1β, and IL-6 are critical links between inflammation and cancer cell proliferation, invasion through activation of NF-κB. Minimizing NFκB expression could be more beneficial than inhibiting IKK in cancer therapy. WDL was found to significantly suppress TNFα, IL‑1β and IL‑6 production in HeLa cells Fig. 2. To the best of our knowledge, this is the first study showing that WDL inhibits inflammatory cytokines in HeLa cells. Michels et al., 27 provided evidence that in the tumor environment TNFα triggers NFκB activation which after that brings about gene expression of anti-apoptotic genes, TNFα itself and IL 1β. Activation of NF-κB also brings about IL-6 expression 28. This, in turn, increases the tumor burden by promoting invasion and migration. Inhibition of TNFα, IL-1β, and IL6 by natural anti-inflammatory drugs could contribute to the reduced expression of NF-κB 29. Our proposition is supported by Yuan et al., 25 who reported that WDL inhibits inflammatory responses via suppression of the NFκB in RAW cells.
To further explore the molecular basis for WDL induced apoptosis in HeLa cancer cells, the expression of apoptosis-related proteins Caspase 3, PARP, Bcl-2, and Bax were analyzed by Western blot. This observation states that WDL induced apoptosis in HeLa cells was triggered by the downregulation of Bcl-2 and the up-regulation of Bax. In our study, there was a dose-dependent increase in ratio of Bax/Bcl-2 Fig. 3.
Similarly increased Caspase 3 and PARP expression in WDL treated HeLa cells show that apoptosis in cervical cancer is mediated through the mitochondria - associated apoptotic pathway. Caspase 3 is the major representative for cell death regulator that cleaves and activates many proteins including PARP. PARP is the enzyme that brings about DNA breakage during the process of programmed cell death 30. Generally, the apoptosis mechanism involves multiple signaling pathways including cancer-elicited inflammatory pathways.
NFκB is the key mediator of inflammatory pathways. Evidence in the literature highlights that natural anti-inflammatory agents including WDL are all NFκB inhibitors 31, 32, 33. NFκB inhibition paves way for the execution of cancer cell apoptosis. Targeting and eliminating inflammation, therefore, induces apoptosis that may lead to better strategies for cervical cancer therapy.
CONCLUSION: The demanding targets in the prevention and treatment of cancer are inflammatory proteins and their pathways. WDL is believed to suppress the inflammatory processes that lead to hyperproliferation. Though several signaling pathways are involved in tumor promotion, targeting inflammatory signaling pathway mediated by NFκB provides more efficacious treatment. Our results might refer the basic for the clinical study of NFκB and inflammatory cytokine inhibitor in cervical cancer therapeutics. Thus, inhibition of inflammation may, therefore, be an attractive approach supported by Wedelolactone for combination therapy.
ACKNOWLEDGEMENT: Nil
SOURCE OF SUPPORT: Nil
CONFLICTS OF INTEREST: The authors declare that there are no conflicts of interest.
REFERENCES:
- Thai TN, Bui TC and Ebell MH: Developing and validating the personal risk of oncogenic human papillomavirus infection score in US women. Family Practice 2019; 4(36): 395-01.
- Todoric J, Antonucci L and Karin M: Targeting inflammation in cancer prevention and therapy. Cancer Prev Res (Phila) 2016; 9(12): 895-05.
- Georgescu SR, Mitran CI, Mitran MI, Caruntu C, Sarbu MI and Matei C: New insights in the pathogenesis of HPV infection and the associated carcinogenic processes: the role of chronic inflammation and oxidative stress. Journal of Immunology Research 2018.
- Savant SS, Sriramkumar S and Hagan HMO: The role of inflammation and inflammatory mediators in the development, progression, metastasis, and chemo-resistance of epithelial ovarian cancer. Cancers 2018; 10(8): 251.
- Olive KP: Fanning the flames of cancer chemoresistance: inflammation and anticancer therapy: J Oncol Pract 2017; 13(3): 181-83.
- Park MH and Hong JT: Roles of NF-κB in cancer and inflammatory diseases and their therapeutic approaches. Cells 2016; 5(2): e15.
- Milovanovic J, Todorovic-Rakovic N and Radulovic M: Interleukin-6 and interleukin-8 serum levels in prognosis of hormone-dependent breast cancer. Cytokine 2018; 118: 93-98.
- Kaltschmidt C, Banz-Jansen C, Benhidjeb, T, Beshay M, Forster C and Greiner J: A role for NF-κB in organ specific cancer and cancer stem cells. Cancers 2019; 11: 655.
- Landskron G, Fuente MDL, Thuwajit P, Thuwajit C and Hermoso MA: Chronic inflammation and cytokines in the tumor microenvironment. J Immunol Res 2014; 149-85.
- Nehybova T, Smarda J, Daniel L, Stiborek M, Kanicky V, Spasojevic I, Preisler J, Damborsky J and Benes P: Wedelolactone Acts as Proteasome Inhibitor in Breast Cancer Cells. Int J Mol Sci 2017; 18(4): 729.
- Sarveswaran S, Ghosh R, Parikh R and Ghosh J: Wedelolactone, an anti-inflammatory botanical, interrupts c-Myc oncogenic signaling and synergizes with enzalutamide to induce apoptosis in prostate cancer Cells. Mol Cancer Ther 2016; 15(11): 2791-01.
- Chen H, Gao S, Li J, Liu D, Sheng C, Yao C, Jiang W, Wu J, Chen S and Huang W: Wedelolactone disrupts the interaction of EZH2-EED complex and inhibits PRC2-dependent cancer .Oncotarget 2015; 6(15): 13049-59.
- Harrington BS and Annunziata CM: NF-κB signaling in Ovarian Cancer. Cancers 2019; 11: 1182.
- Benes P, Knopfova L, Trcka F, Nemajerova A, Pinheiro D, Soucek K, Fojta M and Smarda J: Inhibition of topoisomerase IIα: novel function of wedelolactone. Cancer Lett 2011; 303(1): 29-38.
- Kobori M, Yang Z, Gong D, Heissmeyer V, Zhu H, Jung YK, Gakidis MA, Rao A, Sekine T, Ikegami F, Yuan C and Yuan J: Wedelolactone suppresses LPS-induced caspase-11 expression by directly inhibiting the IKK complex. Cell Death Differ 2004; 11(1): 123-30.
- Lazaro DF: Cell Death: Mechanisms and Pathways in Cancer Cells. Cancer Med J 2018; 1(1): 12-23.
- Pena-Blanco A and Garcıa-Saez AJ: Bax, Bak and beyond - mitochondrial performance in apoptosis. The FEBS Journal 2018; 285: 416-31.
- Das A: Review on cytochrome C. Int J Clinicopathol Correl 2019; 3: 7-11
- Mlynska A, Salciuniene G, Zilionyte K, Garberyte S, Strioga M and Intaite B: Chemokine profiling in serum from patients with ovarian cancer reveals candidate biomarkers for recurrence and immune infiltration. Oncology Reports 2019; 41: 1238-52.
- Bhukya B, Lingabathula H and Yellu NR: Cytotoxic effects of Kydia calycina leaf fractions on different human cancer cell cultures. International Journal of Green Pharmacy 2017; 11(4): 708-13.
- Martinho O, Pinto F, Granja S, Miranda-Gonçalves V, Moreira MA and Ribeiro LF: RKIP inhibition in cervical cancer is associated with higher tumor aggressive behavior and resistance to cisplatin therapy. PLoS One 2013; 8(3): e59104.
- Liskova A, Kubatka P, Samec M, Zubor P, Mlyncek M, Bielik T, Samuel SM, Zulli A, Kwon TK and Busselberg D: Dietary Phytochemicals Targeting Cancer Stem Cells. Molecules 2019; 24:899.
- Shanthini MC and Frances RB: Targeting inflammatory pathways for prevention and therapy of cancer. Nature Reviews Clinical Oncology 2015; 12: 584-96.
- Silva GAF, Nunes RAL, Morale MG, Boccardo E, Aguayo F and Termini L: Oxidative stress: therapeutic approaches for cervical cancer treatment. Clinics (Sao Paulo) 2018; 10(73): e548.
- Yuan F, Chen J, Sun PP, Guan S and Xu J: Wedelolactone inhibits LPS-induced pro-inflammation via NF-kappaB pathway in RAW 264.7 cells. J Biomed Sci 2013; 20: 84.
- Xu D, Lin TH, Yeh CR, Cheng MA, Chen LM, Chang C and Yeh S: The wedelolactone derivative inhibits estrogen receptor-mediated breast, endometrial, and ovarian cancer cells growth. BioMed Research International 2014: 713263.
- Michels N, Van Aart C, Morisse J and Huybrechts I: Chronic inflammation toward cancer incidence: an epidemiological systematic review. Journal of Global Oncology 2018; 4(S2): 24s-24s.
- McFarland BC, Hong SW, Rajbhandari R, Twitty GB, Gray K, Yu H, Benveniste EN and Nozell SE: NF-κB-Induced IL-6 Ensures STAT3 activation and tumor aggressiveness in glioblastoma. PloS One 2013; 8: e78728.
- Linus LO, Hanson C, Alolga1 RN, Zhou W and Qi L: Targeting the key factors of inflammation in cancer: plant intervention. Int J Clin Exp Med 2017; 10(12): 15834-65.
- Rivera M, Ramos Y, Rodriguez-Valentn M, Lopez-Acevedo S, Cubano LA and Zou J: Targeting multiple pro-apoptotic signaling pathways with curcumin in prostate cancer cells. PLoS ONE 2017; 12(6): e0179587.
- Babaei G, Aliarab A, Abroon S, Rasmi Y and Aziz SGG: Application of sesquiterpene lactone: A new promising way for cancer therapy based on anticancer activity. Biomedicine & Pharmacotherapy 2018; 106: 239-46.
- Liu Z, Zhu YY, Li ZY and Ning SQ: Evaluation of the efficacy of paclitaxel with curcumin combination in ovarian cancer cells. Oncol Lett 2016; 12: 3944-48
- Kucirkova T, Stiborek M, Ducka M, Navratilova J, BogdanovicPristov J and Popovic-Bijelic A: Anti-cancer effects of wedelolactone: interactions with copper and subcellular localization. Metallo 2018; 10(10): 1524-31.
How to cite this article:
Christobel RGJ, Jaganathan SS, Abirami MP, Rasappan P and Shila S: A natural coumestan wedelolactone targets inflammatory cytokines to initiate apoptosis in human cervical cancer cells. Int J Pharm Sci & Res 2019; 10(12): 5657-63. doi: 10.13040/IJPSR.0975-8232. 10(12).5657-63.
All © 2013 are reserved by the International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
54
5657-5663
846
1453
English
IJPSR
R. G. J. Christobel, S. S. Jaganathan, M. P. Abirami, P. Rasappan and S. Shila *
Department of Biochemistry, VRR Institute of Biomedical Science (Affiliated to University of Madras), Chennai, Tamil Nadu, India.
shilasamuel72@gmail.com
25 August 2019
26 November 2019
29 November 2019
10.13040/IJPSR.0975-8232.10(12).5657-63
01 December 2019








