ANTI-OSTEOPOROSIS ACTIVITY OF EUCOMMIA, CUSCUTA AND DRYNARIA EXTRACTS IN THE OVARIECTOMIZED RATS
HTML Full TextANTI-OSTEOPOROSIS ACTIVITY OF EUCOMMIA, CUSCUTA AND DRYNARIA EXTRACTS IN THE OVARIECTOMIZED RATS
X. Song, L. Li, Y. Wang, S. Wang *, X. Li, J. Wang, J. Zong, S. Zou and Z. Liu
Chenland Research Institute, 333 Songling Road, Laoshan District, Qingdao city, Shandong Province 266104, China.
ABSTRACT: To observe the effect of Eucommia, Cuscuta, and Drynaria (E.C.D.) extracts in ovariectomized rats and explore the possible mechanisms. Forty-five female Sprague Dawley rats were randomly divided into 5 groups: sham operation group (Sham), ovariectomized group (Model) and ovariectomized rats + treatment group (estradiol valerate of 104.17 mg/kg/day (EV), E.C.D. extracts of 50.08 mg/kg/day (E.C.D.-L), or E.C.D. extracts of 104.17 mg/kg/day (E.C.D.-H), and all the rats were treated by gavage for 8 weeks). Bone metabolism, estrogen index, phosphorus and calcium were compared, and the right femur structural parameters were evaluated by micro-CT. The rat femoral bone specimens were stained using hematoxylin and eosin for pathological examination, and mRNA expression of related genes in bone tissue was detected by real-time quantitative polymerase chain reaction (PCR). We observed E. C. D.-H groups significantly increased serum estrogen levels, and significantly elevated the maximum load and bone mineral density (BMD) levels in bone tissues. EV group and E. C. D.-H groups improved bone metabolism, biomechanical properties, serum phosphorus and calcium indexes. Compared with the model group, bone morphogenetic protein 2 (BMP2), small mothers against decapentaplegic 5 (Smad5), runt-related transcription factor 2 (Runx 2), Wnt3a of the E. C. D.-H groups were significantly increased (p<0.05), the NF-κβ was significantly decreased (p<0.05). In conclusion, E.C.D. extracts can increase the content of serum estradiol E2, improve the BMD and promote bone formation in ovariectomized rats, and the mechanism may be related to the regulation of BMP/Smads pathway and Wnt/β-catenin pathway.
Keywords: E.C.D, Osteoporosis, Ovariectomized rat, Phytoestrogens, BMP/Smads, Wnt/β-catenin
INTRODUCTION: Osteoporosis is a common and frequently occurring disease in post-menopausal women, the elderly and chronic diseases 1, 2, 3.
The main cause of osteoporosis is decreased bone mass and the deterioration of the fine bone structure, resulting in increased bone fragility and fracture risk 1, 2.
It is well known that an in-depth understanding of the pathogenesis of diseases is the key to the study of prevention and treatment measures 1. The incidence of osteoporosis is closely related to vitamin D receptors and type I collagen. At present, the research on the pathogenesis of osteoporosis mainly focuses on receptor activator for nuclear factor-κβ (RANK), RANK ligand (RANKL) and osteoprotegerin (OPG), which determines the dynamic balance between osteoblasts and osteoclasts in-vivo 1. Once the dynamic balance is broken, the differentiation direction of osteoblasts and osteoclasts can be determined 2. Recent research reveals that the role of the immune system can regulate bone cells, and participate in the pathogenesis of the disease; bone protection system and Wnt signaling pathways in the differentiation and activation of osteoclasts and osteoblasts, is crucial in the course of treatment is divided into three aspects 2: first is a preventive treatment, through the functional exercise prescription, etc. 3; Second, use drugs that inhibit bone resorption, such as estrogen, calcitonin, and bisphosphonates. Finally, drugs that promote bone formation, such as calcium supplements, vitamin D derivatives, and fluoride, are used 2, 3.
So, far, there is no very effective method to prevent and treat osteoporosis. Most of them are integrated therapy, which provides an opportunity to prevent and treat osteoporosis with traditional Chinese medicine (TCM). E.C.D. are widely usedas a combination and play a synergy in TCM decoction for osteoporosis treatment 2, 3.
Total lignans (TL) extracted from Eucommia (Eucommia ulmoides Oliv.) barks treatment can effectively suppress the loss of bone mass induced by ovariectomy 2. Cuscuta (Cuscuta chinensis Lam) showed promising effects in the protection against glucocorticoid-induced osteoporosis through protecting osteoblasts and suppressing osteoclastogenesis 2. Drynaria (Drynaria fortunei (Kunze ex Mett.) J. Sm.) showed significant activity on both the proliferation of UMR106 cells and promoting bone mineral density in ovariectomized (OVX) mice 2.
Although traditional Chinese medicine does not have the name "post-menopausal osteoporosis (PMOP)", there are many similar symptoms described in historical literature, PMOP should be under the category of osteoporosis, post-menopausal symptoms. In fact, PMOP should be a disease with kidney deficiency as the root cause 2. There are many methods for osteoporosis building the most commonly used method is to remove ovaries and testes, collectively known as castration 2. We chose the ovariectomized method because of its single construction factor and good reproducibility 2. In this study, SD female rats with bilateral ovaries removed by surgery were used as the research objects, and the bone tissue morphology, bone biomechanics, bone mineral density index, etc. of the rats after E.C.D. extract drug intervention was observed. The protective effect of drugs on bone metabolism was evaluated from the overall and molecular levels to guide the clinical treatment of drugs better.
MATERIALS AND METHODS:
Plant Species Identification: Eucommia (Eucommia ulmoides Oliv.) was purchased from Anhui Zhiliang Traditional Chinese Medicine Decoction Pieces Co., LTD. Cuscuta (Cuscuta chinensis Lam) and Drynaria (Drynaria fortunei (Kunze ex Mett.) J. Sm.) were purchased from Bozhou Traditional Chinese Medicine Commodity Trading Center Co., LTD. HPTLC identified raw medicinal materials according to the method developed by Alkemist Labs (Hoover St, Garden Grove, CA)IDTSOP-72-01 in the U. S.
Prepare of E.C.D. Extracts: The combination of E.C.D. has been developed as an adjunct to dietary supplements for treating osteoporosis (EuBone, Batch No. BH201-20201013-01, Product code: T-4005-1). It is also applying for a patent of novel formula to promote bone repair (patent application number: 2020105750230).
The E.C.D. extracts were made from ground Eucommia, Cuscuta and Drynaria at a ratio of 6:1:3 (theratio is based on the pharmacopoeia recommended dosage and extracts calculation rate) into powder and sieved through a 20-mesh sieve. The extraction process of counter-current extraction (CCE) was based on a previous publication 13. Briefly, the raw material of E. ulmoides, C. chinensis and D. fortune was extracted with 5 L of 95% ethanol 2 times, and the extraction time was 1 h, respectively.
The extract was then filtered and condensed undervacuum and then further dried using a freeze-dryer. To confirm the identity of ingredients, manufacturers use high-performance liquid chromatography (HPLC) to check for the presence of active ingredients, as shown in Table 1.
TABLE 1: THE ACTIVE INGREDIENTS OF E.C.D. EXTRACTS
| Herb | Mark Compound | Acceptance Criteria | Analytical Method |
| Eucommia ulmoides Oliv. | Chlorogenic acid | NLT 0.3% | HPLC |
| Pinoresinol Diglucoside | NLT 0.15% | HPLC | |
| Drynaria fortunei (Kunze ex Mett.) J.Sm. | Naringin | NLT 0.50% | HPLC |
| Cuscuta chinensis Lam | Hyperin | NLT 0.10% | HPLC |
Animals and Treatments: A total of 40 SPF healthy female SD rats (215.6 ± 14.7g) were purchased from Jinan Pengyue Experimental Animal Breeding Co. LTD (certification number: SCXK (Shandong) 2019-0003). The rats received ad libitum access to standard chow pellets and water in 22±3℃, 40-70% humidity. 12 hours of alternating light and dark. After adaptation for 1 week, rats were randomly divided into five groups (n = 8 per group).
Rats were weighed and anesthetized by 10% chloral hydrate and 0.3mL/100g intraperitoneal injection. After anesthesia until there was no blink reflex, the rats were fixed in the abdominal position and the rats were shaved to expose the surgical site under the lowest ribs on both sides and at the intersection of the midaxillary line and about 1-2cm from the lateral spine. After sterilizing the towel with 75% alcohol, the skin, back muscles, and myolemma were cut, and the white glowing cellulite was gently pulled out of the incision with a camera. The cellulite was separated, and pink ovaries were visible.
The lower fallopian tube of the ovary was ligated and then the ovary was removed completely. The other side of the ovary was further removed by the same method and the inner muscle and outer skin were sutured successively and the iodine tincture was applied for disinfection. In the sham operation group, only the ovaries were exposed, but no resection was performed. After operation, the animals were kept in cages and fed normally. Three days after modeling, the animals were given intramuscular penicillin injection with a daily dose of 800,000 units for each animal. Post-surgery, animals were treated to estradiol valerate (PROGYNOVA®; Bayer Healthcare Co., LTD. Guangzhou Branch; Approval No. J20171038) of 104.17 mg/kg/day (EV group), E.C.D. extracts of 52.08 mg/kg/day (E.C.D.-L group), or E.C.D. extracts of 104.17 mg/kg/day (E.C.D.-H group) by oral gavage for 8 weeks. E.C.D. extracts were dissolved in normal saline, the sham operation group and the modelcontrol group were given the same volume of normal saline by gavage.
Serum Chemistry Analysis: After centrifuging at 3000rpm for 10min, serum samples were collected and stored at -20℃ until the detection of enzyme-linked immunosorbent assay (ELISA). The level of serum osteocalcin (BGP), bone-specific alkaline phosphatase (BALP), type I collagen carboxyl end before the peptide (PICP), collagen type Ⅰ N terminal peptide (NTX), serum estradiol E2 and follicle stimulating hormone (FSH) (Jingmei Biotechnology, Yancheng) were determined by commercially ELISA kits according to manufacturer’s instruction using an Multiskan microplate reader (Thermo Fisher, USA). The serum calcium and phosphorus concentration was measured by Siemens ADVIA 2400 blood biochemical analyzer.
Biomechanical Testing: The attached muscle and connective tissue were removed from the left femur and the Instron E10000 universal material mechanical testing machine was used for on-machine testing. During the test, the samples were placed at the two support bars, and the loading rod was located in the center. All samples were loaded at a uniform speed of 3 mm/min. Load until the specimen breaks and record the maximum load that the tested femur sample bears before breaking.
Micro-Computed Tomography (Micro-CT) Detection: Micro-CT of left proximal medial metaphyseal tibia were acquired using Scanco Mct35 scanner (Scanco, Switzerland) at 70KVp, 114μA of 800ms. Bone mineral density, bone volume fraction (BV/TV), bone trabecular number (Tb.N) and trabecular separation degree (TB. Sp) was evaluated based on the micro-CT results.
Hematoxylin and Eosin (H & E) and Toluidine Blue O Staining: Bone demineralization: EDTA decalcified bone tissue specimens with 10% liquid under test for decalcified 8 weeks, replace a piece every 3 days EDTA decalcified liquid, until 1 mL syringe needle stab to the bone tissues, no resistance, decalcified fluid decalcified specimens is washed with water after the completion of several hours to remove attached to the bone tissue of redundant EDTA decalcified liquid and then the femur bones were fixed in 10 neutral buffered formalin solution for 48h, dehydrated in graded ethanol(70%-0%), cleared in xylene, embedded in paraffin, sectioned into 5 m. For H & E stained with hematoxylin for 3-8 min and eosin for 1-3min. For toluidine blue O staining, sections were rinsed in toluidine blue O staining, sections were rinsed in toluidine blue O solution for 1 min. The images were observed by Olympus BX51 light microscopy (Olympus, Japan).
RT-qPCR Detection: Total RNA from bone specimens were extracted using Trizol (Sangon, Shanghai). The RNA quality and quantity were examined using Nanodrop 2000 spctrophotometer (Nanodrop, USA). RT reaction was performed using qPCR RT kit (Transgene, Beijing) according to the manufacturer’s instruction on the ABI9700PCR system (ABI, USA).
The PCR reaction was performed using SYBR Green PCR kit (Transgene, Beijing) on Stratagene Mx3000P Real-time PCR system (Agilent, USA) according to manufacturer's instruction. The primers were shown in Table 2; Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control. Relative expression was calculated using 2−ΔΔCt method and normalized to sham group.
TABLE 2: THE PRIME SEQUENCE OF RT-QPCR
| Primer | Sequence(5'-3') |
| RAT-BMP2-F | GCGATGGACAGCACAGGGACA |
| RAT-BMP2-R | TTGGTGCAAAGACCTGCTAATCCTC |
| RAT-Smad5-F | ACCACCGACAGGATGTAACCA |
| RAT-Smad5-R | GTCAGGACTTTATCCAGCCACT |
| RAT-Runx2-F | GGTACTTCGTCAGCGTCCTATCAG |
| RAT-Runx2-R | CCATCAGCGTCAACACCATCA |
| RAT-Wnt3a-F | GAACTGCACCACTGTCAGCAACA |
| RAT-Wnt3a-R | CCCTGGCATCGGCAAACTC |
| RAT-β-catenin-F | GGACTCTAGTGCAGCTTCTGGGTT |
| RAT-β-catenin-R | CAGATGGCAGGCTCGGTAATG |
| RAT-NF-κβ-F | GGTGGGCAAGCACTGTGAGGA |
| RAT-NF-κβ-R | GGCAAGGTCAGAATGCACCAGAA |
Statistical Analysis: Data were expressed as mean ± standard deviation and compared using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. Statistical analyses were performed using the SPSS 10.0 software (SPSS, USA). Significance was considered at p< 0.05.
RESULTS:
HPTLC Determination: The testing report of plant species identification is shown below Fig. 1. Results of the HPTLC Fig. 1A showed that lanes 5 are the test sample of E. ulmoides extract. Lanes 2, 3, 6, 7 and 8 are the reference samples used for comparison.
This test sample of E. ulmoides extract consistent with the chromatographic profile of the reference samples of E. ulmoides, used above. This test sample of E. ulmoides extract has characteristics of the E. ulmoides herb. Results of the HPTLC Fig. 1B showed that lanes 4 and 5 are the test sample of C. chinensis extract Lanes 2, 3, 6, and 7 are the reference samples used for comparison.
This test sample, C. chinensis extract, has characteristics of the chromatographic profile of C. chinensis reference samples used above. This test sample of C. chinensis extract indicates the presence of C. chinensis seed.
Results of the HPTLC Fig. 1C showed that lanes 4 and 5 are the test sample of D. fortunei extract Lanes 2, 3, 6 and 7 are the reference samples used for comparison.
This test sample, D. fortuneiextract has characteristics of the chromatographic profile of D. fortunei reference samples used above. This test sample of D. fortunei extract indicates the presence of D. fortunei rhizome.
FIG. 1: HIGH-PERFORMANCE THIN LAYER CHROMATOGRAPHY TEST RESULTS OF E.ULMOIDES, D. FORTUNEI AND C. CHINENSIS. (A) The left-side portion 1 is the E. ulmoides standard and the right-side portion 2 is the extract of E. ulmoides. (B) The left-side portion 1 is the C. chinensis standard and the right-side portion 2 is the extract of C. chinensis.(C) The left-side portion 1 is the D. fortunei standard and the right-side portion 2 is the extract of D. fortunei.
Body Weight: The animals in the sham operation group were generally lightweight before modeling. During the modeling administration, the animals in the model group and the drug group gained weight slowly. After 8 weeks, the mean weight of the sham operation group was significantly higher than that of other groups (p<0.05). The weight of animals in drug group 3 increased significantly compared with that in the model group (p<0.05); See Fig. 2 for details.
FIG. 2: WEIGHT MONITORING RESULTS OF ALL GROUPS OF RATS. The data are expressed as means ± SD, n = 9 rats/group. Model, ovariectomized; EV, OVX + estradiol vale rate 1000 mg; E.C.D.-L, OVX + E.C.D. extracts 500 mg; E.C.D.-H, OVX + E.C.D. extracts 1000 mg; Sham, sham-operated; * p< 0 .05 vs the sham group; # p< 0.05 vs model group.
Bone Metabolism and Estrogen Index Test Results: Animal building 8 weeks after the treatment, corresponding to the four bone metabolic index: BGP, BALP, PICP, and NTX, ELISA test results showed that the E.C.D. extract showed an increasing trend compared with the model group, but there was no significant change trend in all groups and no significant difference between groups. The content of E2 in E.C.D.-H group were significantly higher than those in the model group (p<0.05); Compared with the sham group, the content of E2 in the model group and other drug groups was significantly decreased (p<0.05) Fig. 3E and the content of FSH was significantly increased compared with the sham group (p<0.05) Fig. 3F. The results are shown in Fig. 3.
FIG. 3: BONE METABOLISM AND ESTROGEN INDEX TEST RESULTS OF ALL GROUPS. (A) BGP levels; (B) BALP levels; (C) PICP levels; (D) NTX levels; (E) E2 levels; (F) FSH levels. The data are expressed as means ± SD, n = 9 rats/group. Model, ovariectomized; EV, OVX + estradiol vale rate 1000 mg; E.C.D.-L, OVX + E.C.D. extracts 500 mg; E.C.D.-H, OVX + E.C.D. extracts 1000 mg; Sham, sham operated; * p< 0 .05 vs the sham group; # p< 0.05 vs model group.
Serum Phosphorus and Calcium Detection Results: After 8 weeks of animal modeling administration, blood phosphorus levels in estradiol vale rate group were significantly higher than those in the model group and the sham group (p<0.05), compared with the sham group, the blood phosphorus content in E.C.D.-L group was significantly lower (p<0.05), there was no significant difference in blood phosphorus content in other groups Fig. 4A.
FIG. 4: SERUM PHOSPHORUS AND CALCIUM DETECTION RESULTS OF ALL GROUPS. (A) Blood phosphorus content; (B) Blood calcium content. The data are expressed as means ± SD, n = 9 rats/group. Model, ovariectomized; EV, OVX + estradiol valerate 1000 mg; E.C.D.-L, OVX + E.C.D. extracts 500 mg; E.C.D.-H, OVX + E.C.D. extracts 1000 mg; Sham, sham operated; * p< 0 .05 vs the sham group; # p< 0.05 vs model group.
There was no significant difference in blood calcium content between all experimental groups Fig. 4B. There was no difference in blood calcium and phosphorus content between E.C.D-H group and Sham group, as shown in Fig. 4.
Biomechanical Test and Micro-CTScan Results of Femur: The biomechanical test results of the femur of rats showed that the maximum load of the femur of rats in the model group was significantly reduced compared with the sham operation control group (p<0.05). Compared with the model group, the maximum load of E.C.D.-H was significantly higher (p<0.05) Fig. 5A.
Analysis of bone microstructure parameters in the metaphyseal region of the femur showed that BMD, bone volume fraction (BV/TV) and bone trabecular number (Tb. N) were significantly decreased in the model group compared with the sham control group (p<0.05), the trabecular separation degree (TB. Sp) was significantly increased (p<0.05); Compared with the model group, BMD of the E.C.D.-H groups was significantly increased Fig. 5B, and there was no significant difference in all index parameters compared with the control group. See Fig. 5 for the results.
FIG. 5: BIOMECHANICAL TEST AND MICRO-CT SCAN RESULTS OF ALL GROUPS. (A) Maximum load; (B) BMD levels; (C) BV/TV levels; (D) Tb. N levels; (E) Tb.Sp levels. The data are expressed as means ± SD, n = 9 rats/group. Model, ovariectomized; EV, OVX + estradiol valerate 1000 mg; E.C.D.-L, OVX + E.C.D. extracts 500 mg; E.C.D.-H, OVX + E.C.D. extracts 1000 mg; Sham, sham operated;* p< 0 .05 vs the sham group; # p< 0.05 vs model group.
Hematoxylin and Eosin (H&E) and Toluidine Blue O Staining Results: The nuclei are purplish blue with HE staining, and the cytoplasm and extracellular matrix are redor pink. The cytoplasm of the osteoclasts is wine-red and the nuclei are pale blue with TRAP staining. No osteoclast positive staining was found in the sham operation group and the osteoclast positive staining results were found in both the administration group and the model group. See Fig. 6 for the results.
FIG. 6: H & E AND TOLUIDINE BLUE O STAINING RESULTS. (A) Model, ovariectomized; (B) EV, OVX + estradiol valerate 1000 mg; (C) E.C.D.-L, OVX + E.C.D. extracts 500 mg; (D) E.C.D.-H, OVX + E.C.D. extracts 1000 mg; (E) Sham, sham operated.
Fluorescence Quantitative PCR Analysis: Total RNA was isolated and RT-PCR was performed to determine the mRNA expression. Results showed that Wnt3a was significantly decreased in the EuBone-H group compared with the sham control group (p<0.05) Fig. 7C; Compared with the model group,BMP2, Smad5, Runx 2, Wnt3aof the E.C.D.-H groups was significantly increased(p<0.05), the NF-κβ was significantly decreased (p<0.05) Fig. 7F.
FIG. 7: MRNA EXPRESSION RESULTS OF RELATED GENES IN BONE TISSUE. (A) BMP 2; (B) Smad5; (C) Runx 2; (D) Wnt3a; (E) β-catenin; (F) NF-κβ. The data are expressed as means ± SD, n = 9 rats/group. Model, ovariectomized; EV, OVX + estradiol valerate 1000 mg; E.C.D.-L, OVX + E.C.D. extracts 500 mg; E.C.D.-H, OVX + E.C.D. extracts 1000 mg; Sham, sham operated;* p< 0 .05 vs the sham group; # p< 0.05 vs model group.
DISCUSSION: TCM formulas not only reduce bone loss by decreasing bone resorption and increasing bone formation through multi-component and multi-targets 21, but also regulate the body’s function in overall and relieve the pain in back and lumbago 22. The herbal medicine that possess activity of replenishing kidney are often shown to have estrogen-like 23, antioxidant activity or regulating the function of hypothalamus-pituitary axis to enhance the estrogen level in serum and the herbal medicine that reinforce spleen can intensify the effects of to nifying kidney and herbal medicine activating blood can help active chemical constituents to arrive at the skeletonsite and regulate bone metabolism 24. Furthermore, TCM formulas modulate bone metabolism networks modestly and then alleviate the symptom of osteoporosis at low concentrations through exerting synergistic effects of multiple components 25. Therefore, a rationally designed TCM formula can also be considered an option for multitarget therapeutic and prophylactic applications. The development of a standardized, synergistic, safe, and effective TCM formula with robust scientific evidence can offer faster and more economical alternatives.
Aging, estrogen deficiency, chemical drugs, and decreased mechanical loading may cause bone loss leading to osteoporosis 26. The corresponding animal models are respectively castrated osteoporotic models, osteoporotic models caused by drugs, and disused osteoporotic models 27. The investigations of TCM formulas on osteoporotic animals focus on osteoporotic rats induced by ovariectomy, glucocorticoids, and retinoic acid. According to previous studies 13, administration of E.C.D. extracts (Eucommia, Cuscuta, and Drynaria) in experimental GIO rats resulted in decreased expression of RANKL, CTX in serum, increased serum calcium, phosphorus, and OPG level, improved bone density, structural integrity, and biomechanical function in experimental GIO rats. Some specific parameters associated with the animal model should be analyzed to highlight the antiosteoporotic characteristic of TCM formulas. Antiosteoporotic effects of TCM formulas are attributed to active chemical constituents of their herbs. These active constituents are diverse inchemical structure, including flavonoids, saponins, lignans and coumarins, and have the potential to be developed as antiosteoporotic leads 28. Hence, phytochemicals from TCM formulas and the composition of their herbs is of great potentials for the development of novel antiosteoporotic drugs 29. Phytoestrogens can selectively combine with estrogen receptors (ER) in-vivo and have estrogen-like effects by regulating estrogen receptors 30. Phytoestrogens can promote bone formation, inhibit bone resorption and play an important role in bone metabolism of bone marrow mesenchymal stem cells (BMSCs) 31. Fructus Psoraleae (FP) has strong estrogen-like activity and anti-osteoporosis activity by activating the ER-Wnt-β-catenin signaling pathway 32. JIA Min's findings suggest that osthole and imperatorin may represent new pharmacological tools for the treatment of osteoporosis by displaying estrogenic properties or by stimulating osteoblast activity through the ER pathway. Estrogen can inhibit the oxidative stress response and promote the proliferation of osteoblasts through the positive regulatory protein Wnt/β-catenin (the gene-β-catenin of the Drosophila gene Wingless combined with the mouse gene Int1) signaling pathway of osteoblasts 33. The results of this study found that E.C.D. extracts can increase the content of estrogen serum estradiol E2, indicating that it has an estrogen-like effect on ovariectomized rats and promotes bone formation. In addition, the E.C.D. extracts group of ovariectomized rats significantly increased BMD and maximum load, suggesting that E.C.D. extracts can alleviate osteoporosis symptoms in ovariectomized rats by regulating estrogen. The BMP/Smads pathway plays an important regulatory role in the process of bone formation. BMP-2 is a member of the TGF-β superfamily and is highly expressed in bone tissue under normal circumstances. Smad 1/5/8 are downstream signaling molecules of BMP, and Runx2 is an Osteocyte-specific transcription factor that promotes bone formation. When the BMP signal is activated, the downstream Smad1/5/8 will be phosphorylated, causing the nuclear displacement of p-Smad 1/5/8, and further regulating the expression level of the downstream target gene Runx 2 34. Wnt/β-catenin signaling can stimulate osteoblast proliferation and differentiation, and Runx 2 can be activated by Wnt/β-catenin signaling pathway 35. Wnt/β-catenin and BMP-2/Smads signaling pathways are two important signaling pathways 36 that regulate the growth, development and differentiation of osteoblasts, and play an important role in osteoblast differentiation and bone formation 37.
FIG. 8: SCHEMATIC ILLUSTRATING THE MECHANISM BY WHICH E.C.D. EXTRACTS INDUCED THE OSTEOGENIC DIFFERENTIATION. E.C.D. extracts enhanced the activity of the BMP signaling pathway and increased the accumulation of β-catenin by activating the Wnt pathway. Both BMP/Smads and Wnt/β-catenin signaling pathways can up-regulate the expression of Runx 2, a key bone factor, to differentiate osteoblasts.
The results of this study found that E.C.D. extracts could up-regulate the mRNA expression levels of BMP-2, Smad 5, Runx 2 and Wnt 3a in bone tissue and down-regulate the expression of nuclear factor (NF)-κβ, presumably by regulating the BMP/Smads pathway and the Wnt/β-catenin pathway to regulate bone metabolism. Both BMP/Smads and Wnt/β-catenin signaling pathways can up-regulate the expression of Runx 2, a key bone factor, to differentiate osteoblasts 38, thereby significantly increasing bone mineral density and maximum load in ovariectomized rats, as illustrated in Fig. 8.
CONCLUSION: The present study's findings demonstrated that E.C.D. extracts can enhance the bone mineral density and increase serum estrogen levels in ovariectomized rats. It is speculated that the mechanism may be related to the regulation of BMP/Smads pathway and Wnt/β-catenin pathway.
ACKNOWLEDGEMENT: This work was supported by Chenland Nutritionals, Inc.
CONFLICT OF INTEREST: The author declares no conflict of interest.
REFERENCES:
- Zeng Y, Wu J, He X, Li L, Liu X and Liu X: Mechanical microenvironment regulation of age-related diseases involving degeneration of human skeletal and cardiovascular systems. Prog Biophys Mol Biol 2019; 148: 54-59.
- Aggarwal L and Masuda C: Osteoporosis: A quick update. J Fam Pract 2018; 67(2): 59-65.
- Sobieszczańska M, Jonkisz J, Tabin M and Laszki-Szcząchor K: Osteoporosis: genetic determinants and relationship with cardiovascular disease. Adv Clin Exp Med 2013; 22(1): 119-24.
- Chang Y, Huang C, Hwang J, Kuo J, Lin K, Huang H, Bagga S, Kumar A, Chen F and Wu C: Fracture liaison services for osteoporosis in the Asia-Pacific region: current unmet needs and systematic literature review. Osteoporos Int 2018; 29(4): 779-792.
- Lems WF and Raterman HG: Critical issues and current challenges in osteoporosis and fracture prevention. An overview of unmet needs. Ther Adv Musculoskelet Dis 2017; 9(12): 299-316.
- McMillan LB, Zengin A, Ebeling PR and Scott D: Prescribing physical activity for the prevention and treatment of osteoporosis in older adults. Healthcare Basel 2017; 5(4): 85.
- Park K, Ju WC, Yeo JH, Kim JY, Seo HS, Uchida Y and Cho Y: Increased OPG/RANKL ratio in the conditioned medium of soybean-treated osteoblasts suppresses RANKL-induced osteoclast differentiation. Int J Mol Med 2014; 33(1): 178-84.
- Miyamoto T: Mechanism Underlying Post-menopausal Osteoporosis: HIF1α is required for Osteoclast Activation by Estrogen Deficiency. Keio J Med 2015; 64(3): 44-7.
- Chicana B, Donham C, Millan AJ, Manilay JO: Wnt antagonists in hematopoietic and immune cell fate: implications for osteoporosis therapies. Curr Osteoporos Rep 2019; 17(2): 49-58.
- Daly RM, Dalla Via J, Duckham RL, Fraser SF and Helge EW: Exercise for the prevention of osteoporosis in post-menopausal women: an evidence-based guide to the optimal prescription. Braz J Phys Ther 2019; 23(2): 170-180.
- Gambacciani M and Levancini M: Management of post-menopausal osteoporosis and the prevention of fractures. Panminerva Med 2014; 56(2): 115-31.
- Fontenot HB and Harris AL: Pharmacologic management of osteoporosis [J]. J Obstet Gynecol Neonatal Nurs 2014; 43: 236-245.
- Wu L, Ling Z, Feng X, Mao C and Xu Z: Herb medicines against osteoporosis: active compounds & relevant biological mechanisms. Curr Top Med Chem 2017; 17(15): 1670-1691.
- Han J, Li L, Zhang C, Huang Q, Wang S, Li W, Zong J, Li L, Zhao Z, Zhang Z, Liu Z, Wang Q and Shi Y: Eucommia, Cuscuta, and Drynaria extracts ameliorate glucocorticoid-induced osteoporosis by inhibiting osteoclastogenesis through PI3K/Akt pathway. Front Pharmacol 2022; 12: 772944.
- Zhang R, Pan YL, Hu SJ, Kong XH, Juan W and Mei QB: Effects of total lignans from Eucommia ulmoides barks prevent bone loss in-vivo and in-vitro. J Ethnopharmacol 2014; 155(1): 104-12.
- Mo H, Zhang N, Li H, Li F and Pu R: Beneficial effects of Cuscuta chinensis extract on glucocorticoid-induced osteoporosis through modulation of RANKL/OPG signals. Braz J Med Biol Res 2019; 52(12): 8754.
- Wang XL, Wang NL, Zhang Y, Gao H, Pang WY, Wong MS, Zhang G, Qin L and Yao XS: Effects of eleven flavonoids from the osteoprotective fraction of Drynaria fortunei (KUNZE) J. SM. on osteoblastic proliferation using an osteoblast-like cell line. Chem Pharm Bull (Tokyo) 2008; 56(1): 46-51.
- Peng L, Luo Q and Lu H: Efficacy and safety of bazedoxifene in post-menopausal women with osteoporosis: A systematic review and meta-analysis. Medicine (Baltimore) 2017; 96(49): 8659.
- Shahrezaee M, Oryan A, Bastami F, Hosseinpour S, Shahrezaee MH and Kamali A: Comparative impact of systemic delivery of atorvastatin, simvastatin, and lovastatin on bone mineral density of the ovariectomized rats. Endocrine 2018; 60(1): 138-150.
- Saleh N, Nassef NA, Shawky MK, Elshishiny MI and Saleh HA: Novel approach for pathogenesis of osteoporosis in ovariectomized rats as a model of post-menopausal osteoporosis. Exp Gerontol 2020; 137: 110935.
- Ren S, Jiao G, Zhang L, You Y and Chen Y: Bionic tiger-bone powder improves bone microstructure and bone biomechanical strength of ovariectomized rats. Orthop Surg 2021; 13(3): 1111-1118.
- Li Y, Lü SS, Tang GY, Hou M, Tang Q, Zhang XN, Chen WH, Chen G, Xue Q, Zhang CC, Zhang JF, Chen Y and Xu XY: Effect of Morinda officinalis capsule on osteoporosis in ovariectomized rats. Chin J Nat Med 2014; 12(3): 204-12.
- Wong KC, Lee KS, Luk HK, Wan HY, Ho CK, Zhang Y and Wong MS: Er-xian Decoction exerts estrogen-like osteoprotective effects in-vivo and in-vitro. Am J Chin Med 2014; 42(2): 409-26.
- Ge JR, Xie LH, Chen J, Li SQ, Xu HJ, Lai YL, Qiu LL and Ni CB: Liuwei Dihuang Pill treats post-menopausal osteoporosis with Shen (Kidney) Yin Deficiency via Janus kinase/signal transducer and activator of transcription signal pathway by up-regulating cardiotrophin-like cytokine factor 1 expression. Chin J Integr Med 2018; 24(6): 415-422.
- Shuai B, Shen L, Zhu R and Zhou P: Effect of Qing'e formula on the in vitro differentiation of bone marrow-derived mesenchymal stem cells from proximal femurs of post-menopausal osteoporotic mice. BMC Complement Altern Med 2015; 15: 250.
- Tella SH and Gallagher JC: Prevention and treatment of post-menopausal osteoporosis. J Steroid Biochem Mol Biol 2014; 142: 155-70.
- Peng J, Lai ZG and Fang ZL: Dimethyloxalylglycine prevents bone loss in ovariectomized C57BL/6J mice throughenhanced angiogenesis and osteogenesis [J]. PLoS One 2014; 9: 112744.
- Peng J, Lai ZG, Fang ZL, Xing S, Hui K, Hao C, Jin Q, Qi Z, Shen WJ, Dong QN, Bing ZH and Fu DL: Dimethyloxalylglycine prevents bone loss in ovariectomized C57BL/6J mice through enhanced angiogenesis and osteogenesis. PLoS One 2014; 9(11): 112744.
- An J, Yang H, Zhang Q, Liu C, Zhao J, Zhang L and Chen B: Natural products for treatment of osteoporosis: The effects and mechanisms on promoting osteoblast-mediated bone formation. Life Sci 2016; 147: 46-58.
- Wang T, Liu Q, Tjhioe W, Zhao J, Lu A, Zhang G, Tan RX, Zhou M, Xu J and Feng HT: Therapeutic potential and outlook of alternative medicine for osteoporosis. Curr Drug Targets 2017; 18(9): 1051-1068.
- Zhang Y, Liu MW, He Y, Deng N, Chen Y, Huang J and Xie W: Protective effect of resveratrol on estrogen deficiency-induced osteoporosis though attenuating NADPH oxidase 4/nuclear factor kappa B pathway by increasing miR-92b-3p expression. Int J Immunopathol Pharmacol 2020; 34: 2058738420941762.
- Cai XY, Zhang ZJ, Xiong JL, Yang M and Wang ZT: Experimental and molecular docking studies of estrogen-like and anti-osteoporosis activity of compounds in Fructus Psoraleae. J Ethnopharmacol 2021; 276: 114044.
- Jia M, Li Y, Xin HL, Hou TT, Zhang ND, Xu HT, Zhang QY and Qin LP: Estrogenic activity of osthole and imperatorin in MCF-7 cells and their osteoblastic effects in Saos-2 cells. Chin J Nat Med 2016; 14(6): 413-20.
- Han XG, Wang DW, Bi ZG and Gao F: Regulatory effect of estrogen receptor-α-mediated Wnt/β-catenin signaling pathway on osteoblast proliferation. J Biol Regul Homeost Agents 2016; 30(2): 381-7.
- Oichi T, Taniguchi Y, Soma K, Oshima Y, Yano F, Mori Y, Chijimatsu R, Kim-Kaneyama JR, Tanaka S and Saito T: Adamts17 is involved in skeletogenesis through modulation of BMP-Smad1/5/8 pathway. Cell Mol Life Sci 2019; 76(23): 4795-4809.
- Ye M, Zhang C, Zhu L, Jia W and Shen Q: Yak (Bos grunniens) bones collagen-derived peptides stimulate osteoblastic proliferation and differentiation via the activation of Wnt/β-catenin signaling pathway. J Sci Food Agric 2020; 100(6): 2600-2609.
- Lin XF, Fang F, Peng ZQ, Lun WY, Chen ZN, Li GJ and Yao Xm: Effects of Wnt/β-catenin and BMP-2/Smads signaling pathways and interactions on osteoporosis-related diseases. Journal of Zhejiang Chinese Medical University 2019; 43(7): 711-717.
- Fan M, Tang F Ma WK, Lan WY, Li Y, Jiang Z and Cai X: Research progress of Runx2 gene involved in bone metabolic diseases in Wnt/β-catenin signaling pathway. Rheumatism and Arthritis 2019; 8(10): 68-71.
How to cite this article:
Song X, Li L, Wang Y, Wang S, Li X, Wang J, Zong J, Zou S and Liu Z: Anti-osteoporosis activity of Eucommia, Cuscuta and Drynaria extracts in the ovariectomized rats. Int J Pharm Sci & Res 2023; 14(3): 1185-95. doi: 10.13040/IJPSR.0975-8232.14(3).1185-95.
All © 2023 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
15
1185-1195
1505 KB
1229
English
IJPSR
X. Song, L. Li, Y. Wang, S. Wang *, X. Li, J. Wang, J. Zong, S. Zou and Z. Liu
Chenland Research Institute, 333 Songling Road, Laoshan District, Qingdao city, Shandong Province 266104, China.
mwang@chenland.com
15 July 2022
30 August 2022
07 October 2022
10.13040/IJPSR.0975-8232.14(3).1185-95
01 March 2023













