ANTIPROLIFERATIVE EFFECT OF CALOTROPIS GIGANTEA (L.) R. BR. ON BREAST CANCER CELLS MCF-7
HTML Full TextANTIPROLIFERATIVE EFFECT OF CALOTROPIS GIGANTEA (L.) R. BR. ON BREAST CANCER CELLS MCF-7
K. Sumangala Bhat * 1, Abhilasha Sharma 1 and D. K. Venkatramana 2
Department of Biotechnology 1, Acharya Institute of Technology, Acharya Dr. Sarvepalli Radhakrishnan Road, Soldevanahalli, Bangalore - 560107, Karnataka, India.
Bhat Bio-Tech India Pvt Ltd., No. 11A 2, IV Cross, Veerasandra Industrial Area, Electronic City, Bangalore - 560100, Karnataka, India.
ABSTRACT: The investigation was aimed at evaluation of the mechanism of anticancer activity of the glycosides from Calotropis gigantea on breast cancer MCF-7 cells through analysis of modulation of gene expression. Cardiac glycosides were isolated from the leaves of C. gigantea, and the compounds were identified through LC-MS. Influence of the glycoside sample on the expression of p53 and Bcl-2 genes in MCF-7 cells was assessed by comparative RT-PCR of MCF-7 cells treated with the test sample, standard drug, and control followed by validation through colony formation assay. Presence of calactin, calotropin, asceplin, and cymarin along with 4 other unidentified compounds has been detected in the glycoside fraction isolated from the leaf sample of C. gigantea. Influence of the glycosides on the modulation of the expression of tumor suppressor gene p53 indicated a weak down-regulation of its expression, whereas on the modulation of Bcl-2 was found to be drastic with almost absolute inhibition of its expression. Results of the study suggest that cardiac glycosides cast a dual influence on MCF-7 cells, namely cytotoxic effect through down-regulation of p53 gene expression and antiproliferative effect through down-regulation of Bcl-2 gene expression of which latter is more effective.
| Keywords: |
Cardiac glycosides, LC/MS, Gene expression, p53, Bcl-2, Antiproliferative activity
INTRODUCTION: Natural products have been regarded as an important source for potential chemotherapeutic agents. Plant-derived compounds constitute a large segment of chemotherapeutic agents and compounds in current use 1. Despite the evolution of new approaches for discovery, such as combinatorial chemistry and computer-based molecular modeling, the natural product-based approach continues to be one of the productive strategies 2.
Plant latex has been identified as a major source of bioactive prototypes of pharmaceuticals and pesticides 3, 4. Medicinal plants are known to have dynamic immunomodulatory effects by stimulating both nonspecific and specific immunity.
Many of them are well known for their immunomodulatory and antioxidant properties, leading to anticancer activities 5. Phytochemicals such as vitamins, carotenoids, terpenoids, flavonoids, polyphenols, alkaloids, tannins, saponins, pigments, enzymes, and minerals have been found to elicit anticancer activities 6, 7. These chemicals are reported to augment immune mechanism in favor of defense against cancer 8. Members of the genus Calotropis are known to have several medicinal properties and used in medication for a variety of clinical conditions 9-11.
Cytotoxic effect of latex and flower extracts of C. procera on Michigan Cancer Foundation – 7 (MCF-7) and Henrietta Lacks (HeLa) cell lines has been reported by earlier studies 12.
Cardiac glycosides represent an important group of secondary metabolites in wide verities of plants. They are complex and well known for their bioactive influence on cellular activities of animals, including man 13. Cardiac glycosides often used as therapeutic agents for various ailments. In-vitro studies for the inhibition of malignant cell proliferation by cardiac glycosides started in late 1967 14.
Since, then numerous other reports have been confirmed the antiproliferative and apoptotic effects of these compounds in several cancer cell lines, including breast cancer 15-17. Our earlier investigation has detected the presence of calactin, calotropin, asceplin, and cymarin along with 4 other unidentified compounds in the leaves of C. gigantea and cytotoxic effect of the sample on MCF-7 cells under in-vitro conditions 18.
The current study attempts to understand the molecular mechanism of the anticancer effect of the glycosides through analysis of the expression of p53 and Bcl-2 genes.
MATERIALS AND METHODS: All chemicals used in the current study have been procured from Sigma - Aldrich and culture media from Gibco Invitrogen.
Extraction and Isolation of Glycosides: Leaves of C. gigantea Collection No. Abhilasha Sharma, 69858, deposited in Foundation for Revitalization of Local Health Tradition (FRLHT), Bangalore], collected from Acharya Institute campus were shade dried for 15 days at room temperature. Dried leaves were crushed into fine powder. 100gm of leaf powder was macerated with 250 ml 80% methanol. The mixture was agitated with the help of magnetic stirrer for 5 h, and the extract was filtered using Whatman filter paper no. 1. The filtrate was concentrated with the help of simple distillation by removing extra methanol. 6 N HCl (Hydrochloric acid) was added to the filtrate and mixed well. The mixture was kept in a hot air oven at 180 ºC for 24 h. The sediment, comprising glycosides isolated from leaf tissue of the plant was filtered and dried in a hot air oven set at 30 ºC and kept at room temperature for future use.
Analysis of Gene Expression:
Cell Culture: MCF-7 cells [procured from National Centre for Cell Sciences, Pune. India] were seeded in 2 ml Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% Fetal Bovine Serum (FBS) per well in a 6 well plate at a density of 0.4 × 106 and incubated overnight at 37 ºC / 5% CO2 in a CO2 incubator [Nuaire NU 5510E]. 10mg/ml stock of test sample was prepared in DMEM with 10% Dimethyl sulfoxide (DMSO) and was added in a concentration of 2.7 mg/ml (IC50 concentration) to the overnight culture of cells in duplicates. Untreated cells were taken as a negative control whereas 1 µg/ml of doxorubicin was added to the positive control. Incubation was done at 37 ºC /5% CO2 for 48 h and used for RNA isolation 12 and gene expression studies explained in the following section.
Ribonucleic Acid (RNA) Isolation: Total RNA was isolated from the cells by Guanidinium thiocyanate (GITC) method. To the cells, 1ml of GITC solution (4M GITC, 1% β- mercaptoethanol), 50µl of 2M Na- acetate, 500µl of water-saturated phenol and 150 µl of chloroform: isoamyl alcohol (49:1) were added and mixed gently by inverting the tube. The reaction mixture was kept on ice for phase separation and centrifuged at 12000 rpm at 2 ºC for 20 min. The RNA in the aqueous phase was precipitated with 0.6 volume of isopropanol. The pellet was washed with 1ml of 70% ethanol and air dried. The RNA pellet was dissolved in 30 µl of Diethylpyrocarbonate (DEPC) water.
Reverse Transcription Polymerase Chain Reaction (RT-PCR): Reverse transcription of total RNA (3µg) from MCF-7 cells treated with test sample, control or 1µg/ml doxorubicin were performed separately using 200 units of RevertAid™ Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase (Fermentas Life Sciences), oligo dT18 primer and 1mM deoxynucleotide triphosphate (dNTP) mix in a total volume of 20 µl. The reactions were carried out at 42 ºC for 1 h and terminated by heating at 70 ºC.
After reverse transcription, 2µl of complementary Deoxyribonucleic acid (cDNA) was subjected to PCR amplification with the primer pairs for the two marker genes, p53, Bcl-2, and the control housekeeping gene β-actin12. The primers used for PCR were as follows:
β-actin forward: 5’GTGGGGCGCCCCCAGGCA CCA-3’.
β- actin reverse: 5’- CTCCTTAATGTCACGCAC GATTTC-3’.
p 53 forward: 5’CTGAGGTTGGCTCTGACTGT ACCACCATCC-3’.
p 53 reverse: 5’-CTCATTCAGCTCGGAACATC TCGAAGCG-3’;
Bcl-2 forward: 5’- GTTCGGTGGGGTCATGTG TGTGGAGA-3’.
Bcl-2 reverse: 5’-GCTGATTCGACGTTTTGCCT GAAGAC-3’.
PCR reactions were performed in a final volume of 50µl containing 0.3mM of each dNTP, 0.4 µM of each primers, 2.5U of Taq DNA polymerase in 1X PCR reaction buffer. The PCR amplification was performed in a Master cycler® Thermocycler (Eppendorf, Germany) using the following conditions: initial denaturation of 94oC for 2 minutes followed by 35 cycles of denaturation at 94 ºC for 1 min, annealing at 64 ºC (for β-actin and Bcl-2) or 69 ºC (for p53) for 1 min and extension at 72 ºC for 1.2 min and terminated after final extension of 72 ºC for 8 min. 10µl of PCR product was subjected to 1% agarose gel electrophoresis and visualized using ethidium bromide staining. Quantitation of each band was performed by densitometry analysis software Image J and the results expressed as the ratio p53/β-actin or Bcl-2/β-actin in percent to the control.
Colony Formation Assay: MCF-7 cells were seeded in 6 well plates at 800 cells per well. One well was exposed to ultraviolet (UV) light (30 W) for 20 min. Cells in the second well were treated with IC50 concentration (i.e., 2.7 mg/ml) of the glycoside sample, and the third well was kept as the control without any treatment. All cultures were maintained for 7 days at 37 ºC / 5% CO2. After 7 days, cells were stained with methylene blue and the number of colonies of cells was counted by visual screening under a microscope.
RESULTS: To understand the molecular mechanism involved in the anticancer activity of the glycoside sample on MCF-7 cells, two genes, namely p53 (tumor suppressor) and Bcl-2 (anti-apoptotic) have been selected as markers. Isolation of RNA and RT-PCR of the above genes has been carried out to assess the modulatory effect of the glycoside extract on their expression.
Electrophoretic bands of the RT-PCR amplified DNAs of the above genes along with the house keeping gene β-actin (as the control for RT-PCR) are illustrated in Fig. 1.
FIG. 1: ELECTROPHORETIC BANDS OF RT-PCR PRODUCT. M- DNA molecular size marker; S- Sample; Dox- Doxorubicin; C- Medium control
Results of the densitometry analysis of the RT-PCR DNA bands are presented in Table 1.
TABLE 1: DENSITOMETRY ANALYSIS* OF EXPRESSION OF MARKER GENES
| S. no. | Gene
(Treatment) |
Ratio to
β-actin |
% to medium |
| 1 | p53 (Sample) | 0.171836844 | 33.10196462 |
| 2 | p53 (Dox) | 0.161345286 | 31.08091281 |
| 3 | p53 (Medium) | 0.519113731 | 100 |
| 4 | Bcl-2 (Sample) | 0.000248016 | 0.451494793 |
| 5 | Bcl-2 (Dox) | 0.011230081 | 20.44354296 |
| 6 | Bcl-2 (Medium) | 0.054932167 | 100 |
* The densitometry analysis was done using ImageJ software
The result has indicated down-regulation of the expression of both p53 and Bcl-2 under the influence of glycoside sample and the positive control, doxorubicin. However, the extent of down-regulation observed in the case of p53 is much lower than that of Bcl-2 by both the test sample and positive control.
Expression of Bcl-2 was found to be negligibly low, as no DNA band could be detected in samples from treated cells.
The antiproliferative effect of glycoside sample was further confirmed by colony formation assay of MCF-7 cells treated with the glycoside sample at IC50 concentration (i.e. 2.7 mg/ml) in comparison with UV irradiation as a positive control. Results of the colony formation assay are presented in Table 2 and Fig. 2.
TABLE 2: COLONY COUNT OF MCF-7 CELLS UNDER TREATMENT OF GLYCOSIDE SAMPLE
| Treatment | No. of cells seeded | No. of colonies formed* |
| No UV & No extract [Negative control] | 800 CELLS | 25 |
| Only UV
[Positive control 1] |
800 CELLS | 10 |
*Average of 3 replicates
FIG. 2: ANTIPROLIFERATIVE EFFECT OF GLYCOSIDES ON MCF-7 CELLS
A) Untreated cells; B) cells treated with UV light; C) cells treated with the extract
A total of 25 clones of cells were visualized in a culture not exposed to any treatment (Negative control) while 10 clones in culture exposed to UV radiation (Positive control). Cultures exposed to glycoside sample (Test) did not develop any clones after 7 days of incubation, suggesting that the glycoside sample has cytotoxic and anti-proliferative activity on MCF-7 cells.
DISCUSSION: Anticancer property of crude extract of the roots of Calotropis procera has been reported on human oral and central nervous system cancer cell lines 19 Cardiac glycosides are reported to be involved in modulation of gene expression in mammalian cells. The glycoside sample from C. gigantea used in the current study comprised calactin, calotropin, asceplin and cymarin, and 4 other unidentified compounds 18. Role of calactin as an agent inducing apoptosis in human leukemia cells has been confirmed by Lee et al. 21
However, the IC50 value of the test sample (2.7mg/ml) of current study 18 is much higher than that of purified compound reported by Lee et al. 21 Therefore, the real active compound may be at a lower amount, or its activity may be getting interfered by other compounds present in the sample. Purification and comparison of the activity of the purified individual compounds with their synthetic counterparts as well as characterization of the unknown compounds detected in the test sample 18 are being planned to be pursued separately.
The study has further attempted to analyze the influence of the test sample on the expression of tumor marker genes like p53 and Bcl-2. The gene p53 is known for its apoptotic activity via activation of caspase 9. This involves binding of Caspase 9 to cytochrome c and Apaf1. p53 activates the expression of Apaf1 and Bax. Bax, in turn, stimulates the release of cytochrome c from mitochondria leading to apoptosis. This gene is often used as a marker for assessing the anticancer activities of test components in bioassays 22, 23. Bcl-2 is another marker gene employed for anticancer bioassays. Bcl-2 family of proteins have been reported to influence the mitochondrial pathway of apoptosis 24. Bcl-2 of the Bcl-2 family of proteins prevents all mitochondrial changes including cytochrome c release 25, 26 through which it protects cells from undergoing apoptosis via the p53 pathway 22.
The current study has recorded down-regulation of the expression of p53 as well as Bcl-2 by the glycosides from C. gigantea. However, the down-regulation of expression was total in the case of Bcl-2, whereas the expression of p53 was down-regulated to a lesser extent. Therefore, it can be inferred that the tumor suppressor activity of the test sample is mediated more through the downregulation Bcl-2 (i.e. interfering anti-apoptotic activity) than p53 (i.e. facilitating apoptosis).
Similar confirmatory assay on the effect of the test sample on the proliferation of MCF-7 cells in culture through colony formation assay has revealed total arrest of cell proliferation by the test sample and was found to be more effective than UV exposure. This result further confirms above inference that the influence of the test sample is more on Bcl-2 [anti-apoptotic] than on p53 [tumor suppressor]. Hence, it can be concluded that the glycoside sample is anti proliferative and apoptotic in its action on MCF-7 cells.
CONCLUSION: The study has analyzed the influence of cardiac glycoside sample isolated from C. gigantea comprising calactin, calotropin, asceplin, and cymarin and 4 other unidentified compounds on expression of p53 and Bcl-2 genes in breast cancer cells CF-7 under in-vitro conditions. Results of the investigation have confirmed down-regulation of the expression of both the marker genes by the test sample. The effect was more on Bcl-2 than on p53. Hence, it can be concluded that the glycoside sample is antiproliferative and apoptotic in its action on MCF-7 cells.
ACKNOWLEDGEMENT: Nil
CONFLICT OF INTEREST: Nil
REFERENCES:
- Ji HF, LiX J and Zang HY: Natural products and drug discovery. EMBO Reports 2009; 10: 194-00.
- Jagetia GC and Rao SK: Evaluation of the antineoplastic activity of Guduchi (Tinospora cordifolia) in Ehrlich Ascites Carcinoma bearing mice. Biology and Pharma Bulletin 2006; 29: 460-66.
- Upadhyay RK: Plant latex: a natural source of pharmaceuticals and pesticides. International Journal of Green Pharmacy 2011; 5: 169-80.
- Hemalatha RG and Padmini E: Studies on the effect of latex of the milk weed Caloropis procera (Ait.) R. Br. on Angiotensin Converting Enzyme (ACE) activity. Asian Journal of Experimental Biological and Sciences 2010; 1: 803-07.
- Craig WJ: Health-promoting properties of common herbs. The American Journal of Clinical Nutrition 1999; 70: 491S-9S.
- Nawab A, Yunus M, Mahdi AA and Gupta S: Evaluation of anticancer properties of medicinal plants from the Indian subcontinent. Molecular and Cellular Pharmacology 2011; 3: 21-29.
- Pradhan G, Tripathy G and Patanaik S: Anticancer activity of Limonia acidissima (Rutaceae) fruit extracts on human breast cancer cell lines. Tropical Journal of Pharmaceutical Research 2012; 11: 413-19.
- Kumar S: Cardiac glycosides as an anticancer agent. International Journal of Research in Pharmaceutical and Biomedical Sciences 2013; 4: 1371-78.
- Meena AK, Yadav AK, Niranjan AS, Singh B, Nagaria AK, Sharma K, Gourav A, Sharma S and Rao MM: A Review on Calotropis procera and its ethnobotany, phytochemical, pharmacological profile. Drug Invention Today 2010; 2: 185-90.
- Khasawneh MA, Elwy HM, Fawzi NM, Hamza AA, Chevidenkandy AR and Hassan AR: Antioxidant activity lipoxygenase inhibitory effect and polyphenolic compounds from Calotropis procera (Ait.) R. Br. Research Journal of Phytochemistry 2011; 5: 80-88.
- Meena AK, Yadav A and Rao MM: Ayurvedic uses and pharmacological activities of Calotropis procera Asian Journal of Traditional Medicine 2011; 6: 45-53.
- Ranjit PM, Krishnapriya M, Silpa P, Nagalakshmi V, Anjali M, Girish K and Chowdary YA: In-vitro cytotoxic activities of Calotropis procera latex and flower extracts against MCF-7 and Hela cell lines cultures. International Journal of Pharmacy and Pharmaceutical Science 2012; 4: 66-70.
- Kepp O, Menga L, Vacchelli E, Adjemian S, Martins I, Ma Y, Sukkurwala AQ, Michaud M, Galluzzi L, Zitvogel L and Kroemer G: Anticancer activity of cardiac glycosides - at the frontier between cell autonomous and immunological effects. Oncoimmunology 2012; 1: 1640-42.
- Kometiani P, Liu L and Askari A: Digitalis-induced signaling by Na+/K+-ATPase in human breast cancer cells. Molecular Pharmacology 2005: 67: 929-36.
- Shiratori O: Growth inhibitory effect of cardiac glycosides and aglycones on neoplastic cells: in-vitro and in-vivo st Gann 1967; 58: 521-28.
- Bielawski K, Winnicka K and Bielawska A: Inhibition of DNA topoisomerases I and II, and growth inhibition of breast cancer MCF-7 cells by ouabain, digoxin and proscillaridin A. Biology and Pharma Bulletin 2006; 29: 1493-97.
- Lopez-Lazar M, Pastor SSN, Azrak MJA, Caroline AA and Felipe C: Digitoxin inhibits the growth of cancer cell lines at concentrations commonly found in cardiac patients. Journal of Natural Products 2005; 68: 1642-45.
- Bhat SK and Sharma A: Therapeutic potential of cardiac glycosides of gigantea for breast cancer. International Research Journal of Pharmacology 2013; 4: 164-67.
- Bhagat M, Arora JS and Saxena AK: In-vitro cytotoxicity of extracts and fractions of Calotropis procera (Ait.) roots against human cell lines. International Journal of Green Pharmacy 2010; 4: 36-40.
- Abdolmohammadi MH, Fouladdel S, Shafiee A, Amin G, Ghaffari SM and Azizi E: Antiproliferative and apoptotic effect of Astordaucus orientalis (L) drude on T47D human breast cancer cell line: Potential mechanisms of action. African Journal of Biotechnology 2009; 8: 4265-76.
- Lee CC, Lin YH, Chang WH, Wu YC and Chang JG: The small molecule calactin induces DNA damage and apoptosis in human leukemia cell. European Journal Cancer Prevention 2012; 5: 467-73.
- Mbong MA, Gobin KBA, Cornelia B, Neagoe L, Irimie A, Laure JN and Julius EO: Antiproliferative effect of hydroethanolic extracts of seeds of Cola verticillata and leaves of Solanum scabrum. Biology and Medicine 2013; 5: 46-57.
- Laux MT, Aregullin M, Berry JP, Flanders JA and Rodrıguez E: Identification of a p53-dependent pathway in the induction of apoptosis of human breast cancer cells by the natural product, resveratrol. Journal of Alternative and Complementary Medicine 2004; 10: 235-39.
- Athar M, Back H, Kopelovich L, Bickers DR and Kim AL: Multiple molecular targets of resveratrol: anticarcinogenic mechanisms. Archives of Biochemistry and Biophysics 2009; 486: 95-02.
- Jürgensmeier JM, Xie Z, Deveraux Q, Ellerby L, Bredesen D and Reed JC: Bax directly induces the release of cytochrome from isolated mitochondria. Proceedings of National Academy of Sciences of the USA 1998; 95: 4997-02.
- Narita M and Shimizu SIT, Chittenden T, Lutz RJ and Matsuda H: Bax interacts with the permeability transition pore to induce permeability transition and cytochrome c release in isolated mitochondria. Proceedings of National Academy of Sciences of the USA 1998; 95: 14681-86.
How to cite this article:
Bhat KS, Sharma A and Venkatramana DK: Antiproliferative effect of Calotropis gigantea (L.) R. Br. on breast cancer cells MCF-7. Int J Pharm Sci & Res 2014; 5(9): 3918-23. doi: 10.13040/IJPSR.0975-8232.5(9).3918-23.
All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
49
3918-3923
710
1862
English
IJPSR
K. S. Bhat *, A. Sharma and D. K. Venkatramana
Department of Biotechnology, Acharya Institute of Technology, Soldevanahalli, Bangalore, India.
bhat.sumangala@gmail.com
14 March 2014
03 May 2014
21 June 2014
10.13040/IJPSR.0975-8232.5(9).3918-23
01 September 2014







