ASSOCIATION OF TLR2 AND IL-8 POLYMORPHISMS AND THEIR EXPRESSION IN GUILLAIN-BARRÉ SYNDROME
HTML Full TextASSOCIATION OF TLR2 AND IL-8 POLYMORPHISMS AND THEIR EXPRESSION IN GUILLAIN-BARRÉ SYNDROME
- K. Kharwar 1, K. N. Prasad *1, M. Rai 2, V. K. Paliwal 3 and D. R. Modi 4
Department of Microbiology 1, Department of Immunology 2, Department of Neurology 3, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow (U.P.) - 226014, India.
Department of Biotechnology 4, Baba Saheb Bhimrao Ambedaker University, Lucknow (UP) - 226025, India.
ABSTRACT: Guillain-Barré syndrome (GBS) is an acute inflammatory, autoimmune disorder of peripheral nervous system. Association of TLR2 and IL-8 polymorphism with higher expression level has already been studied in many inflammatory and autoimmune diseases. However, the possible role of TLR2 and IL-8 polymorphism in GBS remains unknown. Therefore, the current study investigated the TLR-2 (Arg677Trp & Arg753Gln) and IL-8 (-251A/T) polymorphisms in 105 GBS patients and 100 healthy controls using polymerase chain reaction-restriction fragment length polymorphism analysis. Further, the expression of TLR-2 and IL-8 gene was determined by western blotting and enzyme-linked immunosorbent assay respectively. TLR2 (Arg677Trp & Arg753Gln) heterozygous genotypes were strongly associated with increased risk of GBS. TLR2 and IL-8 genes showed significantly higher expression in GBS when compared with healthy controls. In conclusion, TLR2 polymorphisms showed significant association with GBS, and their enhanced expressions and increased level of IL-8 have possible role in GBS development. TLR2 polymorphisms could be a genetic marker to GBS susceptibility
| Keywords: |
Guillain-Barr´e syndrome, Polymorphism, Expression,
TLR-2 and IL-8
INTRODUCTION: Guillain Barré syndrome (GBS) is an immune-mediated inflammatory disease mainly affecting the myelin and axons of peripheral nerves with heterogeneous pathological features, often triggered by an aberrant immune response towards an infectious pathogen 1. Epidemiological studies linked it with Campylobacter jejuni, Cytomegalovirus, Epstein Barr virus and Mycoplasma pneumonia 2.
The mechanisms involved in immunopathogenesis of GBS are still unclear. The hypothesis put forward for the immunopathogenesis of GBS points to molecular mimicry between lipopolysaccharide (LPS) and ganglioside like epitopes in host nerve cells, which leads to cross reactivity of immune response after the infection. Besides microbial factors, host susceptibility may also play an important role in the etiology of GBS, because not all infected individuals develop this disorder.
It is estimated that only 1:1000 people develop GBS after C. jejuni enteritis, thus highlighting the role of host genetic factors 3. However, limited studies have been conducted for identifying the potential host factors that may impart susceptibility to GBS.
Toll-like receptors (TLRs) family plays a fundamental role in innate immunity and signal the activation of adaptive immunity 4. One of the human Toll homologues, TLR2, has been shown to be involved in LPS signalling 5, 6, 7. In addition to this, TLR2 is activated primarily by peptidoglycan, spirochetal glycolipids, lipoproteins and lipoarabinomannan 8, 9, 10. Activation of TLRs enhances the transcription of several pro-inflammatory cytokines such as IL-1b, IL-6, and TNF-α via NF-κB 11, 12, 13. IL-8 chemokine was characterized for its ability in recruitment and activation of neutrophils at inflammatory sites 14, 15. IL-8 also promotes inflammatory processes by attracting some subsets of T lymphocytes to the site of inflammation, inducing cytokine production as well as releasing tissue damaging mediators by neutrophils 16.
TLR2 polymorphism at position 753 (Arg753Gln), an exchange of arginine by glutamine was correlated with the incidence of sepsis caused by gram-positive bacteria in human 17. Another polymorphism in TLR2 at position 677 (Arg677Trp) was associated with susceptibility to lepromatous leprosy 18. Several studies reported that TLR2 polymorphisms predisposed to autoimmune diseases 19, 20, 21. So far, only one study had shown association of TLR4 polymorphism with GBS 22. Association of IL-8-251A/T polymorphism was studied in autoimmune inflammatory diseases like multiple sclerosis (MS), systemic lupus erythromatosus (SLE) and rheumatoid arthritis (RA) 23, 24, 25.
Taking the importance of TLR2 and IL-8 in genetic susceptibility of various diseases, we hypothesized that host factors might determine the intensity of immune response towards microbial ligands, which might play a pivotal role in GBS development. The precise role of polymorphism & expression of TLR2 and IL-8 are yet not understood in GBS. In present study, we therefore investigated the association of TLR2 (Arg677Trp and Arg753Gln) and IL-8 polymorphisms (-251A/T), and their expressions with GBS.
METHODS:
Study population: Patients admitted to Neurology ward, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow were enrolled for the study. The Institutional ethics committee granted approval for this study and consent was obtained from all the study subjects. A total of 105 patients (male 80) with GBS, mean age ± SD, 30.20 ± 10.98 years, and sex/age matched 100 healthy controls (male 76), mean age 28.12 ± 16.97 years were included in study. GBS patients were selected on the basis of criteria as described earlier 26 and healthy controls were individuals without any history of apparent infectious illness within the preceding 4 weeks. Patients with GBS had not received any immunosuppressive or immunomodulatory treatment in the last 2 months prior to sample collection.
Sample Collection:
Blood samples were collected through peripheral vein puncture during the first 2 weeks after the onset of GBS. Blood in ethylene diamine tetra acetate (EDTA) was stored at -20°C for DNA extraction. Sera from clotted blood were separated and stored at -80°C till further use for enzyme-linked immunosorbent assay (ELISA). Peripheral blood mononuclear cells (PBMCs) were separated from heparinised blood and stored at -20°C for protein extraction.
Genomic DNA isolation:
Genomic DNA was extracted from whole blood using salting out method. DNA samples were stored at -20ºC till further use for genotyping.
TLR-2 genotyping (Arg677Trp& Arg753Gln):
Single nucleotide polymorphisms (SNPs) were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. DNA samples of 100 ng/μl concentration were used for SNP detection; primer sequences for TLR-2 (Arg677Trp& Arg753Gln) amplifications are shown in table1. PCR amplifications were performed in a 25 μL volume containing 10 X assay buffer, 200 mM each of dATP, dCTP, dGTP, dTTP, 0.1 mM of each primer, 1.0 U of Taq DNA polymerase (Bangalore Genei, Bengaluru, India). PCR protocols were as follows: initial denaturation for 10 min at 950C followed by 35 PCR cycles of denaturation for 30 s at 940C, annealing for 30 s at 580C, extension for 30 s at 72 0C with final extension of 5 min at 720C. Amplification products (20 µl) were digested with 1U of AciI (Fermentas, Burlington, Canada) at 370C overnight, electrophoresed on 3.5% agarose (Sigma–Aldrich, St Louis, MO, USA) gel, visualized under UV illumination and stained with ethidium bromide.
IL-8-251 A/T genotyping:
IL-8-251A/T genotype was determined by PCR–RFLP as mentioned above. IL-8 specific primers are shown in Table 1. For RFLP analysis, the PCR products (15 μL) were digested with 1 U of MunI restriction enzyme (Fermentas Life Science, USA) at 370C overnight, electrophoresed on 3.5% agarose (Sigma–Aldrich, St Louis, MO, USA) gel, visualized under UV illumination and stained with ethidium bromide.
TABLE 1: LIST OF PRIMER SEQUENCES FOR TOLL-LIKE RECEPTOR 2 (TLR2) AND INTERLEUKIN 8 (IL-8) GENE POLYMORPHISMS
|
Gene polymorphism |
Method |
Primer sequence | |
| Forward primer Reverse primer | |||
| TLR2 (Arg677Trp) | PCR-RFLP | GGGACTTCATTCCTGGCAAGT | GGCCACTCCAGGTAGGTCTT |
| TLR2 Arg753Gln | PCR-RFLP | GCCTACTGGGTGGAGAACCT | GGCCACTCCAGGTAGGTCTT |
| IL-8(-251T > A) | PCR-RFLP | CATGATAGCATCTGTAATTAACTG | CTCATCTTTTCATTATGTCAG AG |
Western Blotting:
Total protein extracts from PBMCs were prepared by whole cell lysate preparation procedure 27 and supernatants were stored at-20°C. Protein concentration of the cell lysate was determined by Bradford assay method 28. The constituent proteins of the PBMCs were separated by SDS-PAGE on a 10% separating gel and then transferred to nitrocellulose membranes (Sartorius, Gottingen, Germany). In order to verify the equivalent loadings of proteins in the wells, the gel and the nitrocellulose membrane were stained with Coomassie brillant blue and Ponceau S respectively (Sigma). Membranes were blocked by incubation in tris-buffered saline (150 mM NaCl, 25 mM Tris pH 7.5), containing 0.05% Tween 20 (Sigma) and 5% non-fat dry milk and incubated overnight at 40C. Following morning, the membrane was washed in TBS-T (TBS containing 0.05% Tween-20) for 5 min with three changes.
The membrane was then blotted by transferring into a primary anti-rabbit antibody solution (1:1000) and kept at 400C for 6 hrs. The blotted membrane was washed thrice as described before and then transferred into the secondary antibody solution and probed with anti-goat horseradish peroxidase (HRP) conjugated IgG antibody and kept at room temperature for 1 hr. The membrane was washed thrice with TBS-T. HRP development reagent (ECL detection kit, GE Healthcare, Buckinghamshire, UK) was supplied as two solutions, one containing Lumiglo and the other containing peroxide. These two solutions were mixed in the ratio of 1:40 and the membrane was immersed in the mixture for 1 min, wrapped with saran wrap exposed to X-ray film and developed. Density of the proteins on the autoradiogram was quantified by Bio-Rad model GS-700 imaging densitometer using molecular analyst software, version 1.5 (Bio-Rad, CA, USA). The autoradiograms were scanned in the transmittance mode at a resolution setting of 150 dpi, using a gray filter. The Intensity of bands were compared on the basis of adjusted volume (mean optical density area in square millimetres).The densitometric scans from three experiments normalized with native β-actin are shown (Fig.1).
FIG. 1: DENSITOMETRIC SCANS OF REPRESENTATIVE WESTERN BLOTS SHOWING EXPRESSION OF TLR-2 IN CONTROL AND GBS PATIENT FROM THREE EXPERIMENTS, NORMALIZED TO NATIVE β -ACTIN LEVELS
ELISA:
Human IL-8 was measured in the serum using commercial ELISA kit (Invitrogen, Carisbad, USA) following manufacturer’s instruction. All samples were measured in triplicates. For IL-8 serum samples were diluted to a ratio of 1:100 using assay buffer. The detection limit of the kit for IL-8 is 0·31 ng/ml. The optical density of the wells was determined using a microplate reader set at 450 nm.
Statistical analysis:
The SPSS 16.0 statistical package (Chicago, IL, USA) was used for data management and analysis. Power of the study was calculated using Quanto software version 1.0 (http://hydra.usc.edu/gxe) to achieve 80% of the statistical power for Odds Ratio (OR) ≥ 2.0 at significance level (α) <0.05. Logistic regression analysis was applied to estimate association with GBS susceptibility after adjusting for age and gender and considered significant if the p values were <0.05. Hardy-Weinberg equilibrium was checked in controls by goodness of fit χ2 test. For comparisons between the groups of study populations χ2 test was used. ELISA data was expressed as mean ± SD of triplicate experiments performed independently for each sample. One-way anova: Post Hock (Bonferroni) test was performed to determine the expression level of IL-8 and to compare continuous data (age). The statistical significance of the data of Western blot was determined using Student’s t test with Graph Pad Prism software (San Diego, CA, USA) and triplicate experiments performed independently for each sample.
RESULTS:
Genetic polymorphism:
Genotype and allele frequencies in GBS and healthy controls are shown in Tables 2 and 3. Both polymorphisms were in agreement with Hardy-Weinberg equilibrium in controls.
Frequency distribution of the TLR2 Arg753Gln and Arg677Trp Genotype variants in patients with GBS and control groups:
Genotypic distributions of TLR2 Arg753Gln and Arg677Trp polymorphisms demonstrated increased risk of GBS for heterozygous genotypes Arg/Gln (p<0.0001; OR, 8.17; 95% CI, 3.26-20.48) and Arg/Trp (p<0.0001; OR, 86.62; 95% CI, 11.63-644.77). The frequency of wild homozygous genotypes was observed at 65.7% vs 94% for TLR2 Arg753Gln and 53.33% vs 99% for Arg677Trp polymorphisms in patients and controls. Patients with GBS showed significantly higher frequency in comparison to controls for allele 753Gln (17.14% vs 6%, p<0.0006; OR, 3.24; 95% CI, 1.63-6.43) and allele 677Trp (23.34% vs 0.5%, p<0.0001; OR, 60.56; 95% CI, 8.26-443.61) (Table 2).
TABLE 2: TOLL-LIKE RECEPTOR 2 (TLR-2) POLYMORPHISMS IN GBS PATIENTS AND HEALTHY CONTROLS.
| Gene polymorphism | Patients (%) | Controls (%) | p value | OR# (95% CI) |
| TLR2Arg753Gln Genotype | ||||
| Arg/ Arg | 69(65.7%) | 94(94%) | ≤0.0001 | 0.12 (0.04-0.30) |
| Arg /Gln | 36(34.3%) | 6(6%) | ≤0.0001 | 8.17(3.26-20.48) |
| Gln/Gln | 0(0%) | 0(0%) | -- | -- |
| Allele | ||||
| Arg | 174(82.86%) | 188(94%) | 0.0006 | 0.30(0.15-0.61) |
| Gln | 36(17.14%) | 12(6%) | 0.0006 | 3.24 (1.63—6.43) |
| TLR2Arg677Trp Genotype | ||||
| Arg / Arg | 56(53.33%) | 99(99%) | ≤0.0001 | 0.01 (0.001-0.08) |
| Arg /Trp | 49(46.67%) | 1(1%) | ≤0.0001 | 86.62(11.63-644.77) |
| Trp / Trp | 0(0%) | 0(0%) | -- | -- |
| Allele | ||||
| Arg | 161(76.66%) | 199(99.5%) | <0.0001 | 0.01(0.002-0.12) |
| Trp | 49(23.34%) | 1(0.5%) | <0.0001 | 60.56(8.26-443.61) |
Frequency distribution of the IL-8-251 A/T variant in patients with GBS and healthy controls: To analyze the association of IL-8 polymorphisms with GBS, the genotype frequency was compared between controls and patients with GBS. The logistic regression analysis revealed no significant association of IL-8-251A/T polymorphism (polymorphic and heterozygous) with GBS (p=0.8748 and p=0.0698) (data is shown in Table 3).
TABLE 3: IL-8-251A/T POLYMORPHISMS AND GBS SUSCEPTIBILITY
| Gene polymorphism | Patients (%) | Controls (%) | p value | OR# (95% CI) |
| IL-8(-251A/T)
Genotype |
||||
| A/A | 18 (17.14%) | 29 (29%) | 0.0476 | 0.50 (0.26-0.98) |
| A / T | 60(57.14%) | 44(44%) | 0.0698 | 1.69 (0.97-2.94) |
| T /T | 27(25.71%) | 27(27%) | 0.8748 | 0.93 (0.50-1.74) |
| Allele | ||||
| A | 96(45.71%) | 102(51%) | 0.322 | 0.80 (0.54-1.19) |
| T | 114(54.28%) | 98(49%) | 0.322 | 1.23 (0.83-1.82) |
Expressions of IL-8 and TLR2:
Enhanced expression of TLR-2 was observed in GBS patients (fold change-1.112) compared to healthy controls (fold change-1) shown in Fig. 2. Level of IL-8 was elevated in sera of GBS patients than healthy controls (112.55±13.96 vs 34.79±4.373; p≤ 0.001) shown in Fig.3.

FIG. 2: DATA SHOWS THE ENHANCED EXPRESSION OF TLR-2 IN GBS PATIENTS (FOLD CHANGE-1.112) COMPARED TO CONTROLS (FOLD CHANGE 1).

FIG. 3: LEVELS OF IL-8 IN SERUM OF HEALTHY CONTROLS AND GBS PATIENTS
DISCUSSION: In the present study, we investigated the association of TLR2 polymorphism (Arg753Gln and Arg677Trp) with GBS and its relative expression. We also investigated the expression of IL-8 and its gene polymorphism in patients with GBS. TLRs play central role in host defences and are involved in a number of autoimmune diseases including GBS. The magnitude of the association of polymorphisms with autoimmune disease varies depending on genetics, demographics and environmental factors. Many association studies reported that TLR-2 polymorphisms predisposed to autoimmune disease 19, 20, 21. However, some polymorphisms of TLR2 might not be associated with autoimmune disease like rheumatoid arthritis (RA) 29. However, there is no data regarding TLR2 polymorphism with GBS till date.
The importance of TLR2 polymorphism in GBS is still largely unknown. In our study, the variant allele frequency of TLR2-753Gln and TLR2-677Trp was higher in GBS than controls (17.14% vs 6%, p<0.0006; OR, 3.24; 95% CI, 1.63-6.43 & 23.34% vs 0.5%, p<0.0001; OR, 60.56; 95% CI, 8.26-443.61). The reported rate of TLR2-Arg753Gln variant frequency was 1% in Spanish population 30 whereas the TLR2-Arg677Trp was 30.3% in Croatian population 30, 31. In separate studies, the Arg753Gln genotype was observed among 10.34% 32 and 12.3% 33 of healthy Turkish subjects, while the Arg677Trp was not observed. Contrary to the study conducted by Kang et al (2001), other authors failed to detect these TLR2 polymorphisms in the Korean population. In the Caucasian population, the TLR2-Arg753Gln SNP was detected in 9.4% of the German whites, while the Arg677Trp polymorphism was not observed at all 34.
The data regarding role of TLR2 gene polymorphism in inflammatory demyelinating diseases including GBS is limited. There is a single study that suggests association of TLR4 Asp299Gly and Thr399Ile polymorphisms with risk for development of GBS 22.
We conducted the present study in our population and a positive association of TLR2 polymorphism (Arg753Gln and Arg677Trp) was observed with GBS. Polymorphism in the TLR2 gene causes inappropriate activation of the dendritic cells. These dendritic cells kick off cell maturation and increase the expression of major histocompatibility complex (MHC) and co-stimulatory molecule B7, and activate T cells which secrete increased amount of several chemokines and pro-inflammatory cytokines such as TNF-α responsible for demyelination. There are reports which show that increased level of TNF-α contributes to the pathogenesis of immune mediated demyelinating neuropathies and axonal degeneration by inducing damage to myelin 35.
Besides the association of TLR2 with GBS, we also observed the enhanced expression of TLR2 in patient with GBS. The data regarding expression of TLR2 in GBS is very limited. So far, one study showed significantly elevated TLR2 expression in sciatic nerves during GBS 36. An increased expression of TLR2 had been shown in synovial tissues of patients with RA 37.
In the present study, we found elevated TLR2 expression in PBMCs of patients with GBS (fold change-1.112) when compared to healthy control (fold change 1). TLRs play a central role in the initiation of both innate and adaptive immune responses against microbial pathogens through myeloid differentiation (MyD88) dependent primary response gene or MyD88-independent transduction pathway 38. Each member of the TLR family has its own ligand from different pathogens, which helps in inducing a danger signal when pathogen invades the host and results in the activation of NF-?B and subsequent induction of signal transduction cascade. TLR2 can deliver co-stimulatory T cell signals for cell expansion and can induce proliferation of regulatory T cells 39; its signalling favours Th17 cell expansion.
It was shown in the rat model of experimental autoimmune neuritis (EAN) that TLR2 was expressed in inflamed nervous tissue and NF?B was increased in activated T cells and macrophages 40. In EAN, potential endogenous TLR ligands generated following tissue damage or inflammation may also activate their TLRs and thereby play roles in the pathological progress of the disease.TLR2+, CD14+, and Hsp70+cell accumulation was detected and positively correlated with neurologic disease severity in sciatic nerves of EAN rats, suggesting the involvement of innate immunity in the effect or phase of disease 40. From our study, we hypothesize that the increased/enhanced level of TLR2 might deliver potent co-stimulatory signals to antigen activated T cells which secrete increased amount of several chemokine and pro-inflammatory cytokines such as TNF-α responsible for demyelination.
Expression of IL-8 and its role in disease pathogenesis in GBS still remain unknown. An earlier study had shown significantly higher IL-8 secretion from PBMCs of MS patients compared to controls 41. In present study, we found the level of IL-8 significantly higher (112.55±13.96 vs 34.79±4.37; p=0.001) in GBS patients compared to healthy controls. Activation of TLRs enhances the transcription of several pro-inflammatory cytokines such as IL-1b, IL-6, and TNF-α via NF-κB 11, 12, 13.
It is also reported that IL-8 and CXCL1 production by human astrocytes at both the RNA and protein levels can be induced by IL-1β in MS patients 42. In another study, IL-1b and IL-17 induced the production of IL-8 in endothelial and parenchymal cell indicating an indirect role in polymorphonuclear neutrophil recruitment 43. In another study, the level of IL-1b was found significantly higher in chicken model of GBS 44. Elevated expression of TLR2 in GBS as observed in our study indicates that TLR2 activation enhances the transcription of several pro-inflammatory cytokines such as IL-1b, IL-6, and TNF-α via NFκB and IL-1b in turn stimulates the expression of IL-8 that may have indirect role in recruitment and activation of neutrophil at neuronal sites in GBS.
Besides the IL-8 expression study in GBS, we also looked for the polymorphism of IL-8 gene in GBS but we did not observe the any association of IL-8-251A/T polymorphism with our GBS patients. Similar observation in another study reported that functional genetic variation in IL-8 did not play a major role in SLE susceptibility in the Spanish population 24. In another study, the genetic polymorphisms of the CXCL8 gene were not associated with systemic sclerosis. On contrary to these studies, association of IL-8-251 A/T polymorphism with MS was reported in Iranian patients 23.
In summary, our study indicates that TLR2 polymorphisms and their enhanced expressions were associated with GBS susceptibility in Indian patients. In addition, enhanced IL-8 production without its gene polymorphism was also observed in GBS patients. However, interaction between TLR2 activation and expression of IL-8 in absence of IL-8 gene polymorphisms, and their exact role in disease pathogenesis calls for further study. Similar studies in different ethnic populations are required to clarify the role of TLR2 and IL-8 in GBS patients.
ACKNOWLEDGEMENT: Nagendra Kumar Kharwar duly acknowledges the financial assistance from Indian council of medical research (File No. 3/1/2/12-2010-NCD-I).
CONFLICT OF INTEREST: None declared.
AUTHOR CONTRIBUTIONS: NKK and KNP had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept design by KNP and VKP, and DRM; data acquisition, analysis and interpretation by NKK, VKP, MKR and KNP, and manuscript drafting by NKK, DRM and KNP.
REFERENCES:
- Nachamkin I: Chronic effects of Campylobacter infection. Microbes Infect. 2002; 4:399-403.
- Winer JB: guillain Barre Syndrome. MolPathol. 2001; 54:381-5.
- Huizinga R, van den Berg B, van Rijs W, Tio-Gillen AP, Fokkink WJ, Bakker-Jonges LE, Geleijns K, Samsom JN, van Doorn PA, Laman JD, Jacobs BC: Innate Immunity to Campylobacter jejuni in Guillain-Barre Syndrome. Ann Neurol. 2015; 78:343-54.
- Takeda K, Kaisho T, Akira S: Toll-like receptors. Annu Rev Immunol. 2003; 21:335-76.
- Yang RB, Mark MR, Gray A, Huang A, Xie MH, Zhang M, Goddard A, Wood WI, Gurney AL, Godowski PJ: Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling. Nature. 1998; 395:284-8.
- Wright SD: Toll, a new piece in the puzzle of innate immunity. J Exp Med. 1999; 189:605-9.
- Kirschning CJ, Wesche H, Merrill Ayres T, Rothe M: Human toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J Exp Med. 1998; 188:2091-7.
- Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K, Akira S: Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacteria cell wall components. Immunity. 1999; 11:443-51.
- Schroder NW, Opitz B, Lamping N, Michelsen KS, Zahringer U, Gobel UB, Schumann RR: Involvement of lipopolysaccharide binding protein, CD14, and Toll-like receptors in the initiation of innate immune responses by Treponema glycolipids.J Immunol. 2000; 165:2683-93.
- Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ: Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem. 1999; 274:17406-9.
- Kopp EB, Medzhitov R: The Toll-receptor family and control of innate immunity. CurrOpinImmunol. 1999; 11:13-8.
- Akira S, Takeda K, Kaisho T: Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol. 2001; 2:675-80.
- Chow JC, Young DW, Golenbock DT, Christ WJ, Gusovsky F: Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem. 1999; 274:10689-92.
- Baggiolini M, Dewald B, Moser B: Interleukin-8 and related chemotactic cytokines--CXC and CC chemokines. Adv Immunol. 1994; 55:97-179.
- Sampson AP: The role of eosinophils and neutrophils in inflammation. ClinExp Allergy. 2000; 30 Suppl 1:22-7.
- Tecchio C, Cassatella MA: Neutrophil-derived chemokines on the road to immunity. SeminImmunol. 2016; 28:119-28.
- Lorenz E, Mira JP, Cornish KL, Arbour NC, Schwartz DA: A novel polymorphism in the toll-like receptor 2 gene and its potential association with staphylococcal infection. Infect Immun. 2000; 68:6398-401.
- Kang TJ, Chae GT: Detection of Toll-like receptor 2 (TLR2) mutation in the lepromatous leprosy patients. FEMS Immunol Med Microbiol. 2001; 31:53-8.
- Emonts M, Hazes MJ, Houwing-Duistermaat JJ, van der Gaast-de Jongh CE, de Vogel L, Han HK, Wouters JM, Laman JD, Dolhain RJ: Polymorphisms in genes controlling inflammation and tissue repair in rheumatoid arthritis: a case control study. BMC Med Genet. 2011; 12:36.
- Kaiser R, Tang LF, Taylor KE, Sterba K, Nititham J, Brown EE, Edberg JC, McGwin G, Jr., Alarcon GS, Ramsey-Goldman R, Reveille JD, Vila LM, Petri M, Rauch J, Miller E, Mesznik K, Kwok PY, Kimberly RP, Salmon JE, Criswell LA: A polymorphism in TLR2 is associated with arterial thrombosis in a multiethnic population of patients with systemic lupus erythematosus. Arthritis Rheumatol. 2014; 66:1882-7.
- Lee YH, Lee HS, Choi SJ, Ji JD, Song GG: Associations between TLR polymorphisms and systemic lupus erythematosus: a systematic review and meta-analysis. ClinExpRheumatol. 2012; 30:262-5.
- Nyati KK, Prasad KN, Verma A, Singh AK, Rizwan A, Sinha S, Paliwal VK, Pradhan S: Association of TLR4 Asp299Gly and Thr399Ile polymorphisms with Guillain- Barre syndrome in Northern Indian population. J Neuroimmunol. 2010; 218:116-9.
- Kamali-Sarvestani E, Nikseresht AR, Aliparasti MR, Vessal M: IL-8 (-251 A/T) and CXCR2 (+1208 C/T) gene polymorphisms and risk of multiple sclerosis in Iranian patients. Neurosci Lett. 2006; 404:159-62.
- Sanchez E, Sabio JM, Callejas JL, de Ramon E, Garcia-Portales R, Garcia-Hernandez FJ, Jimenez-Alonso J, Gonzalez-Escribano MF, Martin J, Koeleman BP: Association study of genetic variants of pro-inflammatory chemokine and cytokine genes in systemic lupus erythematosus. BMC Med Genet. 2006; 7:48.
- Lo SF, Huang CM, Lin HC, Chen WC, Tsai CH, Tsai FJ: Cytokine (IL-6) and chemokine (IL-8) gene polymorphisms among rheumatoid arthritis patients in Taiwan.ClinExpRheumatol. 2008; 26:632-7.
- Asbury AK, Cornblath DR: Assessment of current diagnostic criteria for Guillain-Barre syndrome. Ann Neurol. 1990; 27 Suppl: S21-4.
- Moberg K, Starz MA, Lees JA: E2F-4 switches from p130 to p107 and pRB in response to cell cycle reentry. Mol Cell Biol. 1996; 16:1436-49.
- Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976; 72:248-54.
- Jaen O, Petit-Teixeira E, Kirsten H, Ahnert P, Semerano L, Pierlot C, Cornelis F, Boissier MC, Falgarone G: No evidence of major effects in several Toll-like receptor gene polymorphisms in rheumatoid arthritis. Arthritis Res Ther. 2009; 11:R5.
- Sanchez E, Orozco G, Lopez-Nevot MA, Jimenez-Alonso J, Martin J: Polymorphisms of toll-like receptor 2 and 4 genes in rheumatoid arthritis and systemic lupus erythematosus. Tissue Antigens. 2004; 63:54-7.
- Ben-Ali M, Barbouche MR, Bousnina S, Chabbou A, Dellagi K: Toll-like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients. ClinDiagn Lab Immunol. 2004; 11:625-6.
- Berdeli A, Celik HA, Ozyurek R, Dogrusoz B, Aydin HH: TLR-2 gene Arg753Gln polymorphism is strongly associated with acute rheumatic fever in children. J Mol Med (Berl). 2005; 83:535-41.
- Berdeli A, Emingil G, Han Saygan B, Gurkan A, Atilla G, Kose T, Baylas H: TLR2 Arg753Gly, TLR4 Asp299Gly and Thr399Ile gene polymorphisms are not associated with chronic periodontitis in a Turkish population. J ClinPeriodontol. 2007; 34:551-7.
- Schroder NW, Hermann C, Hamann L, Gobel UB, Hartung T, Schumann RR: High frequency of polymorphism Arg753Gln of the Toll-like receptor-2 gene detected by a novel allele-specific PCR.J Mol Med (Berl). 2003; 81:368-72.
- Zhang HL, Zheng XY, Zhu J: Th1/Th2/Th17/Treg cytokines in Guillain-Barre syndrome and experimental autoimmune neuritis. Cytokine Growth Factor Rev. 2013;24:443-53.
- Wang YZ, Liang QH, Ramkalawan H, Wang YL, Yang YF, Zhou WB, Tian FF, Li J, Yang H: Expression of Toll-like receptors 2, 4 and 9 in patients with Guillain-Barre syndrome. Neuroimmunomodulation. 2012; 19:60-8.
- Seibl R, Birchler T, Loeliger S, Hossle JP, Gay RE, Saurenmann T, Michel BA, Seger RA, Gay S, Lauener RP: Expression and regulation of Toll-like receptor 2 in rheumatoid arthritis synovium.Am J Pathol. 2003; 162:1221-7.
- Jimenez-Dalmaroni MJ, Gerswhin ME, Adamopoulos IE: The critical role of toll-like receptors--From microbial recognition to autoimmunity: A comprehensive review. Autoimmun Rev. 2016; 15:1-8.
- Mercier BC, Cottalorda A, Coupet CA, Marvel J, Bonnefoy-Berard N: TLR2 engagement on CD8 T cells enables generation of functional memory cells in response to a suboptimal TCR signal. J Immunol. 2009; 182:1860-7.
- Zhang Z, Zhang ZY, Schluesener HJ: Compound A, a plant origin ligand of glucocorticoid receptors, increases regulatory T cells and M2 macrophages to attenuate experimental autoimmune neuritis with reduced side effects. J Immunol. 2009; 183:3081-91.
- Lund BT, Ashikian N, Ta HQ, Chakryan Y, Manoukian K, Groshen S, Gilmore W, Cheema GS, Stohl W, Burnett ME, Ko D, Kachuck NJ, Weiner LP: Increased CXCL8 (IL-8) expression in Multiple Sclerosis. J Neuroimmunol. 2004; 155:161-71.
- Omari KM, John GR, Sealfon SC, Raine CS: CXC chemokine receptors on human oligodendrocytes: implications for multiple sclerosis. Brain. 2005; 128:1003-15.
- Fossiez F, Djossou O, Chomarat P, Flores-Romo L, Ait-Yahia S, Maat C, Pin JJ, Garrone P, Garcia E, Saeland S, Blanchard D, Gaillard C, Das Mahapatra B, Rouvier E, Golstein P, Banchereau J, Lebecque S: T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med. 1996; 183:2593-603.
- Nyati KK, Prasad KN, Kharwar NK, Soni P, Husain N, Agrawal V, Jain AK: Immunopathology and Th1/Th2 immune response of Campylobacter jejuni-induced paralysis resembling Guillain-Barre syndrome in chicken. Med MicrobiolImmunol. 2012; 201:177-87.
How to cite this article:
Kharwar NK, Prasad KN, Rai M, Paliwal VK and Modi DR: Association of TLR2 and IL-8 Polymorphisms and Their Expression in Guillain-Barré Syndrome. Int J Pharm Sci Res 2016; 7(9): 3695-02.doi: 10.13040/IJPSR.0975-8232.7(9).3695-02.
All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
16
3695-02
681
1671
English
IJPSR
N. K. Kharwar, K. N. Prasad *, M. Rai, V. K. Paliwal and D. R. Modi
Department of Microbiology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow (U.P.), India
knprasad@sgpgi.ac.in
12 April, 2016
15 June, 2016
29 June, 2016
10.13040/IJPSR.0975-8232.7(9).3695-02
01 September 2016






