BIOPROSPECTING FOR LIPASE PRODUCING MICROORGANISMS
HTML Full TextBIOPROSPECTING FOR LIPASE PRODUCING MICROORGANISMS
Erumalla Venkatanagaraju *, P. S. Shiva Prasad, Jincy A. George, M. F. Jerin Jill, Aishwarya B. George and Jobi Xavier
Department of Life Sciences, Christ (Deemed to be University), Hosur Road, Bengaluru - 560029, Karnataka, India.
ABSTRACT: Extracellular lipases are ubiquitous in occurrence and are essential for various applications such as organic synthesis, hydrolysis of fats and oils, modification of fats, flavor enhancement in food processing, resolution of racemic mixtures and chemical analysis. In the present study, an attempt was made to screen and characterize potent extracellular lipase producing bacteria from the pond water of Dakshina Kashi Kshetra, Antharagange, Vibhuthipura Village, Kolar Taluk, and Kolar District, Karnataka, India. Based on the ability to produce extracellular lipase the isolate was selected and identified through 16S rRNA sequencing as Acinetobacter nosocomialis.
| Keywords: |
Extracellular lipases, Hydrolysis, Dakshina kashi, 16S rRNA sequencing, Acinetobacter nosocomialis
INTRODUCTION: The exploitation of micro-organisms is widely used in many different industry sectors, such as agricultural, chemical, environmental, food, health, etc. 1 Enzyme are delicate protein molecules found in all living organisms, and are necessary for cell growth and differentiation 2. The extracellular lipases are ubiquitous in occurrence and are essential for various applications such as organic synthesis, hydrolysis of fats and oils, modification of fats, flavor enhancement in food processing, resolution of racemic mixtures and chemical analysis 3. The lipase enzymes are well known as a subclass of hydrolases 4.
Lipases (glycerol-ester-hydrolases, E.C.3.1.1.3.) are carboxylesterases that are capable of catalyzing the hydrolysis of triglycerides into diglycerides, monoglycerides, free fatty acids and glycerol 5, 6. Lipases are the single class of enzymes which play an important part in the metabolism of many microorganisms like species of Pseudomonas sp. Pseudomonas fragi 7, Pseudomonas fluorescent 8, 9, Pseudomonas sp. ATCC 21808, 10, 11 Pseudomonas cepacia 12, 13, Pseudomonas putida 3SK 14 and Pseudomonas aeruginosa 15.
Bacillus sp. 16, 17, 18, Bacillus thermocatenulates 19, Bacillus pumilus 20, Bacillus alcalophilus 21, Bacillus stearothermophilus 22. Rhizopus sp., Rhizopus japonicas NR 400, 23 Rhizopus oryzae 24, 25, Rhizopus delemar 26, Rhizopus arrhizus 27, Rhizopus chinensis 28. Penicillium sp., Penicillium cyclopium MI, 29, 30 Penicillium simplicissimum 31, Penicillium expansum DSM 1994, 32 Penicillium citrinum 33, 34, Penicillium chrysogenum 35. In this research, an attempt was made for the screening and characterization of potential lipase-producing microorganisms from a pond water sample of Dakshina Kashi Kshetra, Antharagange, Vibhuthipura Village, Kolar Taluk, and Kolar District, Karnataka, India.
MATERIALS AND METHODS:
Experimental Chemicals: All chemicals and reagents used in this research were of analytical grade and are mostly purchased from Sigma USA and Hi-media Mumbai.
Collection and Preparation of Sample: Water samples were collected from the pond of Dakshina Kashi Kshetra, Antharagange, Vibhuthipura Village, Kolar Taluk, and Kolar District, Karnataka, India. The samples were labeled and preserved at 8 ºC 36. Before isolation of lipase-producing microbes, the samples were centrifuged at 10,000 rpm for 5 min at 37 °C, and the resultant pellet was suspended in distilled water 37, 38 for the isolating lipase promising microbes.
Isolation of Lipase Producing Microorganisms by Plate Assay: The suspended sample of 100 µl was inoculated on tributyrin agar plates containing per liter of peptone, 5 g; yeast extract, 3 g; tributyrin, 10 ml, and agar-agar, 20 g followed by incubation for 24 h at 37 °C to visualize the micro-organisms promising for extracellular lipases 39, 40. A clear zone around the growth of the bacteria was indicated to extracellular lipase activity.
Molecular Characterization of Selected Extra-cellular Lipase Producing Microorganism: The molecular identification of the selected strain was carried out by sequencing and analysis of the 16S rRNA gene. Therefore, genomic DNA was extracted with the commercial kit Qiagen and the partial 16S gene was amplified as described by Hiraishietal 41, using the pair of primers 16S-F: AGAGTTTGATCCTGGCTCAG and 16S-R: AAGGAGGTGATCCAGCCGCA. The reaction consisted of 50 μl containing 1× buffer of Taq DNA polymerase, 0.2 mM of each dNTP, 0.5 μM of each primer, 2 mM of magnesium chloride, 1 U of Taq DNA polymerase (Invitrogen), 50 ng of genomic DNA, and the final volume adjusted with ultrapure water. The program used for PCR was 94ºC for 240 sec, followed by 35 cycles of 94 ºC for 30 sec, 50 ºC for 30 sec and 72 ºC for 30 sec and finally, extension at 72 ºC for 360 sec.
Subsequently, the amplification product was cleaned and analyzed on BDT v3.1 cycle sequencer on ABI3730XL, Genetic Analyzer. The consensus sequence of the 16S rDNA gene was generated from forward and reverse sequence data using aligner software. The 16S rDNA gene sequence was used to carry out BLAST with the database of the NCBI genebank database. Based on maximum identity score first ten sequences were selected and aligned using multiple alignment software program Clustal W. Distance matrix was generated, and the phylogenetic tree was constructed using MEGA 7. 42, 43
RESULTS AND DISCUSSION:
Screening and Molecular Characterization of Lipolytic Bacteria: The water sample was placed on tributyrin agar media (TBA), after 24 h incubation period seventeen colonies were identified for extracellular lipase activity Fig. 1. Best four colonies were streaked on TBA media for confirming the enzyme activity Fig. 2. Based on the zone of clearance one colony was subjected to molecular identification and identified as Acinetobacter nosocomialis Fig. 3, 4 and 5.
BLASTn search of this nucleotide sequence with the most similar 16S rRNA gene sequences of the Gen Bank database (http:// www. ncbi.nlm.nih. gov/blast) revealed the closest sequence identities from the sequence database. All the similarities have been summarized in Table 1.
In BLASTn analysis, nucleotide test sequence of lipase-producing bacteria showed 99% homology with A. Nosocomialis strain PE5, 16S ribosomal RNA, partial sequence (MF943157.1), 99% homology with partial sequence of A. nosocomialis strain GTC 03313 (LC014122.1), partial sequence of Acinetobacter nosocomialis strain GTC 03312 (LC014121.1), partial sequence of Acinetobacter nosocomialis strain ST02 (MH368653.1), partial sequence of Acinetobacter nosocomialis strain NBRC 110498 (LC014141.1), partial sequence of Acinetobacter genomo sp. 13TU (FJ860871.1), partial sequence of Acinetobacter pittiistrain C_12 (KT748635.1), partial sequence of Acinetobacter dijkshoorniae strain JVAP01 (NR_152082.1), partial sequence of Acinetobacter lactucae strain NRRL B-41902 (NR_152004.1). Sequence analysis revealed that bacterial sample is identical to Acinetobacter nosocomialisas it showed maximum homology (99%) with Acinetobacter nosocomialis strain PE5. Thus, the bacterial isolate was identified as Acinetobacter nosocomialis strain PE5 Fig. 6.
TABLE 1: PERCENT HOMOLOGY OF NUCLEOTIDE QUERY SEQUENCE OF LIPASE PRODUCING BACTERIAL ISOLATE WITH OTHER NUCLEOTIDE SEQUENCES PRESENT IN THE DATABASE USING BLASTn ANALYSIS
| Accession no. | Description | Percent of Homology |
| MF943157.1 | Acinetobacter nosocomialis strain PE5 | 99% |
| LC014122.1 | Acinetobacter nosocomialis strain GTC 03313 | 99% |
| LC014121.1 | Acinetobacter nosocomialis strain GTC 03312 | 99% |
| MH368653.1 | Acinetobacter nosocomialis strain ST02 | 99% |
| LC014141.1 | Acinetobacter nosocomialis strain NBRC 110498 | 99% |
| FJ860871.1 | Acinetobacter genomo sp. 13TU | 99% |
| KT748635.1 | Acinetobacter pittii strain C_12 | 99% |
| KT748634.1 | Acinetobacter pittii strain BR_12 | 99% |
| NR_152082.1 | Acinetobacter dijkshoorniae strain JVAP01 | 99% |
| NR_152004.1 | Acinetobacter lactucae strain NRRL B-41902 | 99% |
FIG. 6: COLOUR KEY FOR ALIGNMENT SCORE OF NUCLEOTIDE QUERY SEQUENCE OF BACTERIAL ISOLATE WITH OTHER NUCLEOTIDE SEQUENCES PRESENT IN THE DATABASE USING BLAST ANALYSIS (RED LINES SHOW THE SIMILARITY OF THE QUERY SEQUENCE IS MORE THAN 200)
Molecular Phylogenetic Analysis by Maximum Likelihood Method: The evolutionary history was inferred by using the maximum likelihood method based on the Kimura 2-parameter model 42. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed 43. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches 43. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the maximum composite likelihood (MCL) approach and then selecting the topology with superior log-likelihood value. The analysis involved 11 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 1459 positions in the final dataset. Evolutionary analyses were conducted in MEGA7. 43
FIG. 7: PHYLOGENETIC TREE OF GENUS ACINETOBACTER 16S rRNA. THE GENE BANK ACCESSION NUMBERS OF THE ANALYZED SEQUENCES ARE SHOWN. A TOTAL 100 BOOTSTRAP REPLICATES WERE PERFORMED, AND THE BOOTSTRAP VALUES ARE INDICATED AT THE BRANCH POINTS
CONCLUSION: Keeping in view the industrial importance of extracellular lipases, researchers are more and more focusing on discovering bacterial extracellular lipases with novel properties to meet the industrial requirements as well as increasing demand of global enzyme market. The search for promising strains of bacterial extracellular lipase producers is a continuous process. The isolates which show higher lipase activity were selected for molecular characterization. The organism was identified as Acinetobacter nosocomialis. Based on data obtained in the present work, it can be concluded that Acinetobacter species isolates can be employed in the production of important industrial lipases.
ACKNOWLEDGEMENT: The authors would like to thank Dr. (Fr) Thomas C. Mathew, Vice Chancellor, Christ (Deemed to be University), Bengaluru, for encouraging and supporting us throughout our review work and also thank Mr. William Joseph for helping in sample collection.
CONFLICT OF INTEREST: The authors declare no conflict of interest.
REFERENCES:
- Caterina T, Misu M, Alexandra G, Maria P, Mariana V, Radu T and Adrian V: Microbial screening for lipase and amylase production using newly isolated strains from various biotopes. Series F Biotechnologies 2015; 19: 271-80.
- Venkatanagaraju E and Divakar G: Screening and isolation of fibrinolytic protease producing mesophilic bacteria from slaughterhouses in Bangalore. International Journal of Pharmaceutical Sciences and Research 2013; 4(9): 3625-29.
- Aravindan R, Anbumathi P and Viruthagiri T: Lipase applications in the food industry. Indian Journal of Biotechnology 2007; 6: 141-58.
- Almeida AF, Tauk TS and Carmona EC: Acid lipase from Candida viswanathii production, biochemical properties, and potential application. Biomed Res Int 2013; 2: 1-10.
- Paiva AL, Balcao VM and Malcata FX: Kinetics and mechanisms of reactions catalyzed by immobilized lipases. Enzyme and Microbial Technology 2000; 27(3): 187-90.
- Lee HK, Ahn MJ, Kwak SH, Song WH and Jeong BC: Purification and characterization of cold active lipase from psychrotrophic Aeromonas sp. LPB 4. The Journal of Microbiology 2003; 41(1): 22-27.
- Nishio T, Chikano T and Kamimura M: Purification and some properties of lipase produced by Pseudomonas fragi39B. Agric Biol Chem 1987; 51: 181-86.
- Kojima Y, Yokoe M and Mase T: Purification and characterization of an alkaline lipase from Pseudomonas fluorescens Biosci Biotechnol Biochem 1994; 58: 1564-68.
- Kordel M, Hofman, B, Schomburg D and Schmid RD: Extracellular lipase of Pseudomonas sp. strain ATCC 21808: purification, characterization, crystallization and preliminary X-ray diffraction data. J Bacteriol 1991; 173, 4836-41.
- Sztajer H and Bryjak M: Capillar membranes for purification of Pseudomonas fluorescens Bio-process Eng 1989; 4: 257-59.
- Kim JW, Shim YS and Yoon SS: Isolation and purification of a lipase from Pseudomonas sp. Y0103 isolated from raw milk. Korean J Dairy Sci 1997; 19: 17-24.
- Dunhaupt A, Lang S and Wagner F: Properties and partial purification of Pseudomonas cepacia Lipases: Structure, mechanism and genetic engineering. GBF Monographs. VCH, Weinheim 1991: 389-92.
- Terstappen GC, Geerts AJ and Kula MR: The use of detergent-based aqueous two-phase systems for the isolation of extracellular proteins: purification of a lipase from Pseudomonas cepacia. Biotechnol Appl Biochem 1992; 16: 228-35.
- Lee SY and Rhee JS: Production and partial purification of a lipase from Pseudomonas putida Enzyme Microb Technol 1993; 15: 617-23.
- Sharon C, Furugoh S, Yamakido T, Ogawa HI and Kato Y: Purification and characterization of a lipase from Pseudomonas aeruginosa KKA-5 and its role in castor oil hydrolysis. J Ind Microbiol Biotech 1998; 20: 304-07.
- Sugihara A, Tani T and Tominaga Y: Purification and characterization of a novel thermostable lipase from Bacillus sp. J Biochem 1991; 109: 211-16.
- Dharmsthiti S and Luchai S: Production, purification and characterization of thermophilic lipase from Bacillus sp. THL027. FEMS Microbiol Lett 1999; 179: 241-46.
- Imamura S and Kitaura S: Purification and characteri-zation of a monoacylglycerol lipase from the moderately thermophilic Bacillus sp. H-257. J Biochem 2000; 127: 419-25.
- Schmidt DC, Rua ML, Atomi H and Schmid RD: Thermoalkalophilic lipase of Bacillus thermocatenulatus: I. Molecular cloning, nucleotide sequence, purification and some properties. Biochim Biophys Acta 1996; 1301: 105-14.
- Jose J and Kurup GM: Purification and characterization of an extracellular lipase from a newly isolated thermophilic Bacillus pumilus. Indian J Exp Biol 1999; 37: 1213-17.
- Ghanem EH, Al-Sayed HA and Saleh KM: An alkalophilic thermostable lipase produced by a new isolate of Bacillus alcalophilus. World J Microbiol Biotechnol 2000; 16: 459-64.
- Kim MH, Kim HK, Lee JK, Park SY and Oh TK: Thermostable lipase of Bacillus stearothermophilus, high level production, purification and calcium-dependent thermostability. Korea Res. Inst Biosci Biotechnol 2000; 64: 280-86.
- Suzuki M, Yamamoto H and Mizugaki M: Purification and general properties of a metalinsensitive lipase from NR. 400. JBiochem 1986; 100: 1207- 1213.
- Razak CNA, Salleh AB, Musani R, Samad MY and Basri M: Some characteristics of lipases from thermophilic fungi isolated from palm oil mill effluent. J Mol Catal 1997; 3: 153-59.
- Hiol A, Jonzo MD, Rugani N, Druet D, Sarda L and Comeau LC: Purification and characterization of an extracellular lipase from a thermophilic Rhizopus oryzae strain isolated from palm fruit. Enzyme Microb Technol 2000; 26: 421-30.
- Haas MJ, Cichowicz DJ and Bailey DG: Purification and characterization of an extracellular lipase from the fungus Rhizopus delemar. Lipids 1992; 27: 571-76.
- Chattopadhyay M, Banik AK and Raychaudhuri S: Production and purification of lipase by a mutant strain of Rhizopus arrhizus. Folia Microbiol 1999; 44: 37-40.
- Yasuda M, Ogino H, Kiguchi T, Kotani T, Takakura S, Ishibashi T, Nakashima T, Fukuda H and Ishikawa H: Purification and characterization of lipase from Rhizopus chinensis J Ferment Bioeng 2000; 88: 571-73.
- Isobe K, Akiba T and Yamaguchi S: Crystallization and characterization of lipase from Penicillium cyclopium. Agric Biol Chem 1988; 52: 41-47.
- Chahinian H, Vanot G, Ibrik A, Rugani N, Sarda L and Comeau LC: Production of extracellular lipases by Penicillium cyclopium. Biosci Biotechnol Biochem 2000; 64: 215-22.
- Sztajer H, Lunsdorf H, Erdman H, Menge U and Schmid R: Purification and properties of lipase from Penicillium simplicissimum. Biochim Biophys Acta 1992; 1124: 253-61.
- Stocklein W, Sztajer H, Menge U and Schmid RD: Purification and properties of a lipase from Penicillium expansum. BiochimBiophys Acta 1993; 1168: 181-89.
- Krieger N, Taipa MA, AiresBarros MR, Melo EHM, LimaFilho JL and Cabral JMS: Purification of the Penicillium citrinum lipase using AOT reversed micelles. J Chem Technol Biotechnol 1997; 69: 77-85.
- Krieger N, Taipa MA, Melo EHM, LimaFilho JL, AiresBarros MR and Cabral JMS: Purification of the Penicillium citrinum lipase by chromatographic processes. Bioprocess Eng 1999; 20: 59-65.
- Ferrer M, Plon FJ, Nuero OM, Reyes F and Ballesteros A: Purification and properties of a lipase from Penicillium chrysogenum isolated from industrial wastes. J Chem Technol Biotechnol 2000; 75: 569-76.
- Manali B, Sumit S, Smarajit M and Sudipta R: Isolation of lipase-producing bacteria and determination of their lipase activity from a vegetative oil contaminated soil. International Research Journal of Basic and Applied Sciences 2016; 1(2): 4-7.
- Venkatanagaraju E and Divakar G: Bacillus cereus GD 55 strain improvement by physical and chemical mutagenesis for enhanced production of fibrinolytic protease. Inter-national Journal of Pharma Sciences and Research 2013; 4(5): 81-93.
- Venkatanagaraju E, Chittaranjan D and Akihito C: Non-recombinant mutagenesis of Bacillus subtilis MTCC 2414 for hyper production of laccase. Asian Journal of Pharmaceutical and Health Sciences 2016; 6(4): 1569-74.
- Shubham V and Kanti PS: Isolation, identification and characterization of lipase-producing microorganisms from environment. Asian J Pharm Clin Res 2014; 7(4): 219-22.
- Singh MG, Chandra V and Abhishek M: Isolation and screening of lipase-producing microorganisms from natural sources. Indian Journal of Ecology 2017; 44(1): 19-23.
- Hiraishi A: Direct automated sequencing of 16S rDNA amplified by a polymerase chain reaction from bacterial cultures without DNA purification. Letters in Applied Microbiology 1992; 15(5): 210-13.
- Kimura M: A simple method for estimating the evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 1980; 16: 111-20.
- Felsenstein J: Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985; 39: 783-91.
How to cite this article:
Venkatanagaraju E, Prasad PSS, George JA, Jill MFJ, George AB and Xavier J: Bioprospecting for lipase producing microorganisms. Int J Pharm Sci & Res 2019; 10(5): 2348-52. doi: 10.13040/IJPSR.0975-8232.10(5).2348-52.
All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
33
2348-2352
564
1445
English
IJPSR
E. Venkatanagaraju *, P. S. S. Prasad, J. A. George, M. F. J. Jill, A. B. George and J. Xavier
Department of Life Sciences, Christ (Deemed to be University), Bengaluru, Karnataka, India.
venkatanagarajue@gmail.com
28 August 2018
03 November 2018
09 November 2018
10.13040/IJPSR.0975-8232.10(5).2348-52
01 May 2019









