DETECTION OF HUMAN NOROVIRUS IN ACUTE GASTROENTERITIS CASES FROM NORTH INDIAN PEDIATRIC POPULATION
HTML Full TextDETECTION OF HUMAN NOROVIRUS IN ACUTE GASTROENTERITIS CASES FROM NORTH INDIAN PEDIATRIC POPULATION
Suman, Dharamveer Singh, Rambha Tripathi, Jyoti Umrao, Piyali Bhattacharya, Ujjala Ghoshal and Tapan N. Dhole *
Department of Microbiology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow - 226014, Uttar Pradesh, India.
ABSTRACT: Introduction: Human Norovirus (HuNoV) is the major cause of acute gastroenteritis in pediatric populations, accounting for approximately 18% of cases worldwide. The aim of this study was to determine the prevalence rate and characterization of genogroup in the pediatric population with gastrointestinal disease. Materials and Methods: A total of 205 fecal specimens were taken from children below 15 years of age with acute gastroenteritis disease. Samples were collected from the pediatric department of Sanjay Gandhi Post Graduate Institute of Medical Sciences, Luck now. RNA was extracted from fecal specimens and screened for Norovirus GI and GII genogroups using real-time PCR. Results: The overall rate of Norovirus infections was 23 (11.2%). Among patients positive for Norovirus, 17(74.0%) were identified as GII genogroup, and 6 (26.0%) were identified as GI genogroup. Conclusion: The majority of Norovirus associated viral gastroenteritis cases among children were attributed to GII genogroup. Younger patients were at more risk of acute gastroenteritis. As the viral transmission was evident by the oral-fecal route, the high positivity of clinical samples is indicative of disease manifestation in the area. Simultaneously, some cases are positive for Norovirus etiology suggests its circulation in the community.
| Keywords: |
Acute gastroenteritis, Human Norovirus (HuNoV), Real-time Reverse transcriptase Polymerase chain reaction (PCR), Diarrhea
INTRODUCTION: Viral gastroenteritis is an important cause of childhood morbidity and mortality worldwide, especially in developing countries 1. It is characterized by immense inflammation of the gastrointestinal tract membranes, leading to frequent vomiting and/or diarrhea. Even though acute gastroenteritis can cause severe dehydration, leading to further complications and Hospitalization 2.
Human Noroviruses (HuNoVs) are widespread and highly contagious viruses that cause major outbreaks of gastroenteritis in people of all age groups worldwide 3. The prevalence of HuNoV in children with acute gastroenteritis (AGE) is in the range of 6–48% 4.
Human Norovirus (HuNoV) belongs to the family Caliciviridae and genus Norovirus; these viruses are small non-enveloped, icosahedral viruses with approximately 38 nm diameter 5. The genome consists of a single-stranded positive-sense RNA of approximately 7.5 kb with a poly (A) tail at the 3' end of the genomes contains three open reading frames (ORFs). ORF1 is the largest and encodes a polyprotein precursor for several non-structural proteins, including NTPase proteinase and RNA dependent RNA polymerase (RdRp) 6. ORF2 encodes the capsid protein 7 and ORF3 the smallest, encodes a protein of unknown function that has been suggested to be a minor component of the virion 8.
On the basis of sequence similarity, HuNoV is composed of at least 41 genotypes, which are classified into seven recognized genogroups (GI–GVII) 9-10. Genogroups GI, GII, and GIV primarily infect humans 11. Multiple porcine norovirus belong to GII 12-14, although bovine and murine noroviruses are classified into genogroups GIII and GV, respectively 15-16. Canine noroviruses are grouped within genogroups GIV, GVI, and GVII. Each genogroup is further divided into genotypes or genoclusters on the basis of pairwise sequence comparisons 11, 17. Genogroup I contains 14 clusters, and genogroup II has 17 clusters maximum of the strains infect humans 18.
Norovirus infections in humans cause symptoms of severe vomiting, abdominal cramps, watery diarrhea, fever, malaise, and nausea 19. Primary infection is caused due to the ingestion of fecally contaminated food or water, while secondary infection transmits from person-to-person contact, aerosolized vomits, fomites, and infected food handlers. The average incubation period is 24-48 h 20-21. Low-level transmission can occur via contaminated drinking water when surface water or groundwater supplies are contaminated 22.
The lack of a tissue culture system for the cultivation of HuNoV has been a significant obstacle to study this group, but recent advances in cloning and sequencing of NoV have enabled their detection and genomic characterization in stool and environmental samples 18. The application of these newer assays has significantly increased the recognition of the importance of HuNoV as the cause of sporadic and outbreak-associated gastroenteritis. Sequencing and phylogenetic analysis of a highly conserved region of the capsid region and RNA-dependent RNA polymerase (RdRp) were used to detect and characterize HuNoV in clinical and environmental samples. Molecular characterization of HuNoV isolates was first performed using semi-nested RT-PCR assays 23. Nested RT-PCR tests able to amplify longer PCR products were designed for GI and GII 23-24. Real-time reverse transcription PCR (real-time RT-PCR) is currently the gold standard for sensitive and accurate detection of these viruses and serves a critical tool in outbreak prevention and control 25. Various studies in different parts of India have identified gastroenteritis is caused by HuNoV 24-27.
The aim of the present study was to determine the prevalence of HuNoV in children with gastro-enteritis in the North Indian pediatric population and their genomic characterization along with prevalence.
MATERIALS AND METHODS:
Sample Collection and Preparation: The present study is a cross-sectional hospital-based survey. A total of 205 fecal samples collected from clinically suspected children below 15 years age, suffering from acute gastroenteritis within 48-72 h, OPD (outpatients) and IPD (admitted patients) of the General Hospital, Sanjay Gandhi Post Graduate Institute of Medical Sciences (S.G.P.G.I.M.S.), Lucknow during 2015-2017. Maximum no. of the samples were collected in the winter season. Acute gastroenteritis is a descriptive term for inflammation of the gastrointestinal tract from any cause like toxins, viruses, bacteria, parasites, and chemicals. It commonly presents as the sudden onset of diarrhea and/or vomiting. Diarrhea is defined as more frequent (>= 3 per day) and loose stools three or more times per day. Gastrointestinal infected patients selected on the basis of the following symptom: watery diarrhea and vomiting with fever, dehydration, and abdominal cramps ("stomach ache") with the duration of illness between 24 h and less than 14 days and also recruited by written informed consent at the time of enrollment. Samples were stored at -20 ºC until use. The samples were prepared as 10% (wt/vol) suspensions of stool in phosphate-buffered saline (PBS) by mixing and centrifugation at 13000 rpm for 20 min at 4 ºC. The supernatant was used for RNA extraction.
RNA Extraction from Stool Specimens: Viral RNA was extracted from 140 μl of a 10% stool suspension with a QIAamp viral RNA kit (Qiagen,) according to the manufacturer's instructions. RNA was eluted with 50 μl of elution buffer and kept at -80 °C for further analysis.
cDNA Synthesis: Complementary DNA (cDNA) was synthesized using the superscript III (Invitrogen) kit as per manufactures instruction. Briefly, 5 μl of RNA was mixed with 1 μl of 10 mM dNTPs mix, 1 μl of 50 ng/ml random hexamer primer 3 μl RNase free water. The mixture was incubated at 65 °C for 5 min then place on ice for 1 min followed by the addition of 2 μl of 10X RT-buffer, 1 μl of 200 U/ml of Superscript III-RT, 1 μl of 40 U/ml of RNase out, 4μl of 25mM MgCl2 and 2μl of 0.1mM DTT. The reaction was incubated at 50 °C for 50 min followed by at 85 °C for 5 min to terminate the reaction and cDNA was stored at -80°C for further analysis.
Detection of Human Norovirus by Real-Time PCR: Real-time PCR was carried out in a final volume of 20 μl of a reaction mixture, containing 2 μl of cDNA, 10 μl of 2x TaqMan Universal PCR Master Mix (Applied Biosystems). Having 10 pmol of forward and reverse primer along with 5 pmol of TaqMan probe Table 1 the reaction mixture was held at 50 °C and 95 °C for 10 min followed by 45 cycles for 15 sec at 95 °C and at 60 °C for 1 min.
TABLE 1: PRIMER AND PROBES OLIGO-NUCLEOTIDES USED FOR REAL-TIME PCR 16
| Genogroups | Oligonucleotides | Sequence (5- 3) | Location |
| GI | COGIF + | CGYTGGATGCGNTTYCATGA | 5291 |
| COGIR - | CTTAGACGCCATCATCATTYAC | 5375 | |
| RINGI(a) -TP | FAM-AGATYGCGATCYCCTGTCCA-BHQ1 | 5340 | |
| RINGI(b) -TP | FAM-AGATCGCGGTCTCCTGTCCA-BHQ1 | 5340 | |
| GII | COG2F + | CARGARBCNATGTTYAGRTGGATGG | 5003 |
| COG2R - | TCGACGCCATCTTCATTCACA | 5100 | |
| RING2-TP + | FAM-TGGGAGGGCGATCGCAATCT-BHQ1 | 5048 |
Statistical Analysis: The data were evaluated for statistical significance with the Chi-square test and Fisher’s exact test, where appropriate. All tests were two-tailed, and the value of p<0.05 was considered to represent a statistically significant difference.
Ethics Statement: The study protocol was approved by the Ethics Committee of Sanjay Gandhi Post Graduate Institute of Medical Sciences, Raibareli Road, Lucknow, U.P. (IEC code: 2015-126 PhD-87).
RESULTS: During the 3 years study period, a total of 205 children below 15 years of age suffered from acute gastroenteritis (AGE) were tested for HuNoV infection. Fecal specimens were collected within 48 to 72 h of symptoms. All samples (205 fecal specimens) were evaluated with Real-time PCR diagnostic techniques. The total positivity for HuNoV in AGE patients was 23 (11.21%); among them, 6 (26%) were GI genogroup, and 17 (74%) were identified as GII genogroup.
TABLE 2: DEMOGRAPHICAL DATA OF ACUTE GASTROENTERITIS PATIENTS
| Characteristic
|
Total specimens
n=205 (%) |
Norovirus negative specimens, n=182 (%) | Norovirus positive specimens, n=23 (%) | P value |
| Age groups
0-5 years 5-10 years 10-15 years |
97 (47.3%) 46 (22.4%) 62 (30.2%) |
79 (43.4%) 43 (23.6%) 60 (33.0%) |
18 (78.3%) 3 (13.0%) 2 (8.7%) |
<0.037*
|
| Gender
Male Female |
94 (45.9%) 111 (54.1%) |
84(46.2%) 98(53.8%) |
10 (43.5%) 13 (56.5%) |
0.971
|
| Residence
Rural Urban |
88 (42.9%) 117 (57.1%) |
72(39.6%) 100(54.9%) |
16 (69.5%) 07 (30.4%) |
<0.038* |
| Season
Rainy Winter Summer |
85 (41.5%) 62 (30.2%) 58 (28.3%) |
72 (39.6%) 58 (31.9%) 52 (28.6%) |
13 (56.5%) 04 (17.4%) 06 (26.1%) |
0.579
|
P = comparisons were made using chi-square or Fisher’s exact test for categorical variables. *= shows a statically significant difference (p<0.05).
In total HuNoV positive cases, 78.3% belonged to age group 0-5 years which have a greater risk of acute gastroenteritis. Children between 5-10 years old represented the reduced positivity (13.0%) and lowest 8.7% in 10-15 years old children presented in Fig. 1. The association between the Norovirus infection and different age groups was statistically analyzed by the chi-squared test and Fisher`s exact t-test. It was a statistically significant difference between the age groups (p<0.036*) depicted in table no.2. Among the positive cases, 10 (43.5%) were male, and 13 (56.5%) were female, and the male/female (M/F) ratio was 1:1.3. The gender distribution of norovirus-positive in AGE cases did not show any statistically significant (p>0.971) Table 2. A summary of the demographic characteristics and clinical manifestations of the patients is given in Table 2 and Table 3.
FIG. 1: NOROVIRUS INFECTION IN DIFFERENT AGE GROUPS OF GASTROENTERITIS PATIENTS
Out of 205 fecal samples from AGE patients, among them, 88 (42.92%) and 117 (57.1%) samples were from rural and urban areas children, respectively. The majority of norovirus infection found in children from rural areas 16 (69.5%) compared with children living in urban areas 07 (30.4%), it was statistically significant (p<0.038*) Table 2. In this study, NoV infections were detected during the year. Overall, infections were recorded higher during the rainy season 13 (56.5%) and the infection rate was very low 6 (26.1%) occurred during the summer season followed by winter season 04 (17.4%). Among the total norovirus positive samples in AGE patients, main clinical manifestations were a diarrhea (n=23, 100%), nausea (n=5, 21.7%), vomiting (n=21, 91.3%), abdominal pain (n=7, 30.4%), and fever (n=4, 17.4%), which is statistically significant (p<0.004*) presented in Table 3.
TABLE 3: CLINICAL MANIFESTATIONS OF GASTROENTERITIS PATIENTS POSITIVE FOR HUMAN NOROVIRUS
| Symptoms | Number of Sample n=205 | Positive Sample n=23 | P value |
| Diarrhea | 150 (73.2%) | 23 (100%) | |
| Nausea | 142 (69.3%) | 5 (21.7%) | |
| Vomiting | 134 (65.5%) | 21(91.3%) | <0.004* |
| Abdominal pain | 120 (58.7%) | 7 (30.4%) | |
| Fever | 50 (24.4%) | 4 (17.4%) |
#Value of P≤0.05 was considered as significant and marked with an asterisk (*)
All 23 (11.2%) norovirus positive samples were characterized into 2 genogroups (GI and GII). Human norovirus-GII (n=17, 74%) was predominant genogroup as compare to genogroup GI (n=6, 26%) depicted in Fig. 2.
FIG. 2: DISTRIBUTION OF NOROVIRUS GENOGROUPS
DISCUSSION: In the present research, we conducted an epidemiological study of HuNoV infection in North Indian pediatric patients under the age of 15 years, who were suffering from acute gastroenteritis during the study period (2015-2017).
HuNoV is water and food-borne pathogens related to acute gastroenteritis in children, transmitted by contaminated water and the fecal-oral route 23, 28. It is well known viral pathogen that causes sporadic and epidemic diarrhea in both children and adults, but more frequently in children, and the GII genogroup was the leading cause of the disease 27, 29.
Previous studies provide information on NoV prevalence in many countries, including 15% in Nicaragua, 30% in Iraq, 30-31, 5.5% in Vietnam, 9.3% in Tunisia, 32-33, 11.3% in Malawi, 34 and 12% in Thailand 35. However, NoV prevalence was reported from different regions of India and found to be 44.4% from Chennai, while 11.2% were reported from Southern India 36-37. A study conducted in Hyderabad, Telangana State showed 5% positivity for NoV 38. An earlier report on the sporadic cases of acute gastroenteritis has been reported, 12.5% prevalence of NoV in Pune and 6.3% in Nagpur 39-40.
This study demonstrated the use of RT-PCR as a reliable tool for the detection of NoV in children. In summary, NoV infections are a common cause of pediatric gastroenteritis in Northern India. To assess the role of pre-infection in protecting from the accurate rate of infection with NoV subsequent infection or illness in this community, it will be interesting to investigate asymptomatic shedding and immune responses. The majority of the studies show that GII is the foremost cause of diarrhea in humans. In our study, we were found the high percentage of GII genogroup (74%) in contrast to GI (26%) in positive Nov cases which was similar to the previous reports of South India and other regions of the world 41-44.
In the present study, 23/205 (11.21%) NoV was detected from fecal specimens in children, and a significantly higher prevalence rate was seen among less than 5 years of children, indicating an association with gastroenteritis. GII strain of Norovirus was detected 17/23 (74%) and GI as 6/23 (26%). Out of five genogroups, the GII genogroup was predominantly found in NoV positive cases. However, it is very interesting to note that the prevalence of NoV in this area is exceptionally low unlike majority of studies from India and other counties, which reports NoV as a very major diarrheagenic pathogen in both sporadic and epidemic cases 29, 43.
The predominant clinical manifestations observed, as in other studies, were vomiting, diarrhea, nausea, abdominal pain, and to a lesser extent fever 45-46. Children are likely to experience vomiting more frequently than diarrhea. In this study, we found predominant symptom was vomiting, diarrhea, and nausea similarly reported from Delhi 47.
Our study shows that the age group between 0-5 years of children were at high risk of acute gastroenteritis in NoV positive cases. The results were similarly reported from Western India, South Africa, and Pakistan 40, 48-49. The high exposure rate of NoV in children existing in rural communities is prone to reflect their substantial exposure to enteric pathogens, possibly as a result of poor hygiene practices and sanitation. Previous studies have reported that NoV mainly peaked in the winter season, which is in concordance with our study 43. Female children were predominant in our study.
CONCLUSION: There are currently no approved Norovirus vaccines available 50-51. Challenges related to vaccine production include the inability to grow the virus in culture, limited knowledge of human norovirus immunology from antigenic diversity, and evaluation of adolescent vaccine presentation. However, the effectiveness of a commercially available NoV vaccine in the developing world would rely on factors such as the need for protection of the cold chain, costs and incorporation into an already crowded immunization system.
ACKNOWLEDGEMENT: This study is supported by WHO, NPSP project, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Luck now, UP. The author, Suman, duly acknowledges Prof. S. K. Mandal for his support in statistical analysis, Mrs. Sneha Ghildiyal, Manjari Baluni, Mr. V. K. Mishra, and Mr. Hemant Verma for providing technical as well as writing assistance during the work.
CONFLICTS OF INTEREST: The authors declare that there is no conflict of interest regarding the publication of this paper.
REFERENCES:
- El-Qazoui M, Oumzil H and Baassi L: Rotavirus and norovirus infections among acute gastroenteritis children in Morocco. BMC Infectious Diseases 2014; 14: 300.
- Oldak E, Sulik A and Rozkiewicz D: Norovirus infections in children under 5 years of age hospitalized due to the acute viral gastroenteritis in northeastern Poland. European Journal of Clinical Microbiology & Infectious Diseases 2012; 31: 417-22.
- Fields B, Knipe D and Howley P: Fields virology. Vol. 2 Wolters Kluwer Health. Lippincott Williams & Wilkins Philadelphia 2013.
- Koopmans M: Progress in understanding norovirus epidemiology. Current Opinion in Infectious Diseases 2008; 21: 544-52.
- Motoya T, Umezawa M and Saito A: Variation of human norovirus GII genotypes detected in Ibaraki, Japan, during 2012–2018. Gut Pathogens 2019; 11: 26.
- Liu B, Clarke IN and Lambden PR: Polyprotein processing in Southampton virus: identification of 3C-like protease cleavage sites by in-vitro Journal of Virology 1996; 70: 2605-2610.
- Jiang X, Wang M and Graham DY: Expression, self-assembly, and antigenicity of the Norwalk virus capsid protein. Journal of Virology 1992; 66: 6527-32.
- Glass PJ, White LJ and Ball JM: Norwalk virus open reading frame 3 encodes a minor structural protein. Journal of Virology 2000; 74: 6581-91.
- Tse H, Lau SK and Chan WM: Complete genome sequences of novel canine noroviruses in Hong Kong. Am Soc Microbiol 2012.
- Vinjé J: Advances in laboratory methods for detection and typing of norovirus. Journal of Clinical Microbiology 2015; 53: 373-81.
- Zheng DP, Ando T and Fankhauser RL: Norovirus classification and proposed strain nomenclature. Virology 2006; 346: 312-23.
- Sugieda M, Nagaoka H and Kakishima Y: Detection of Norwalk-like virus genes in the caecum contents of pigs. Archives of Virology 1998; 143: 1215-21.
- Wang Q-H, Han MG and Cheetham S: Porcine noroviruses related to human noroviruses. Emerging Infectious Diseases 2005; 11: 1874.
- Wang Q-H, Costantini V and Saif LJ: Porcine enteric caliciviruses: genetic and antigenic relatedness to human caliciviruses, diagnosis and epidemiology. Vaccine 2007; 25: 5453-66.
- Hsu CC, Riley LK and Livingston RS: Molecular characterization of three novel murine noroviruses. Virus genes 2007; 34: 147-155.
- Liu B, Lambden P and Günther H: Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. Journal of Virology 1999; 73: 819-25.
- Hoffmann D, Mauroy A and Seebach J: New norovirus classified as a recombinant GII. g/GII. 1 causes an extended foodborne outbreak at a university hospital in Munich. Journal of Clinical Virology 2013; 58: 24-30.
- Kageyama T, Shinohara M and Uchida K: Coexistence of multiple genotypes, including newly identified genotypes, in outbreaks of gastroenteritis due to Norovirus in Japan. Journal of Clinical Microbiology 2004; 42: 2988-95.
- Hutson AM, Atmar RL and Estes MK: Norovirus disease: changing epidemiology and host susceptibility factors. Trends in Microbiology 2004; 12: 279-87.
- Brugha R, Vipond I and Evans MR: A community outbreak of food-borne small round-structured virus gastroenteritis caused by a contaminated water supply. Epidemiology & Infection 1999; 122: 145-54.
- Koopmans M, Vinjé J and de Wit M: Molecular epidemiology of human enteric caliciviruses in The Netherlands. The Journal of Infectious Diseases 2000; 181: S262-S269.
- Beuret C, Kohler D and Baumgartner A: Norwalk-like virus sequences in mineral waters: one-year monitoring of three brands. Applied and Environmental Microbiology 2002; 68: 1925-31.
- Kitajima M, Haramoto E and Phanuwan C: Molecular detection and genotyping of human noroviruses in influent and effluent water at a wastewater treatment plant in Japan. J of Applied Microbiology 2012; 112: 605-13.
- La Rosa G, Fontana S and Di Grazia A: Molecular identification and genetic analysis of norovirus genogroups I and II in water environments: comparative analysis of different reverse transcription-PCR assays. Applied and Environmental Microbiology 2007; 73: 4152-61.
- Yoo JE, Lee C and Park S: Evaluation of various real-time reverse transcription quantitative PCR assays for norovirus detection. J Microbiol Biotechnol 2017; 27: 816-24.
- Gupta S, Singh K and Jain A: A etiology of childhood viral gastroenteritis in Lucknow, north India. The Indian Journal of Medical Research 2015; 141: 469.
- Jain S, Thakur N and Grover N: Prevalence of rotavirus, norovirus and enterovirus in diarrheal diseases in Himachal Pradesh, India. Virus Disease 2016; 27: 77-83.
- Burke RM, Shih S-M, Yen C, et al. Burden of Severe Norovirus Disease in Taiwan, 2003–2013. Clinical Infectious Diseases 2018.
- Menon VK, George S and Ramani S: Genogroup IIb norovirus infections and association with enteric symptoms in a neonatal nursery in southern India. Journal of Clinical Microbiology 2010; 48: 3212-15.
- Bucardo F, Nordgren J and Carlsson B: Pediatric norovirus diarrhea in Nicaragua. Journal of Clinical Microbiology 2008; 46: 2573-80.
- Al‐Mashhadani MN, Nakagomi O and Dove W: Norovirus gastroenteritis among children in Iraqi Kurdistan. Journal of Medical Virology 2008; 80: 506-09.
- Nguyen TA, Yagyu F and Okame M: Diversity of viruses associated with acute gastroenteritis in children hospitalized with diarrhea in Ho Chi Minh City, Vietnam. Journal of Medical Virology 2007; 79: 582-590.
- Hassine‐Zaafrane M, Sdiri‐Loulizi K and Kaplon J: Prevalence and genetic diversity of norovirus infection in Tunisian children (2007–2010). Journal of Medical Virology 2013; 85: 1100-10.
- Trainor E, Lopman B and Iturriza‐Gomara M: Detection and molecular characterisation of noroviruses in hospitalised children in Malawi, 1997–2007. Journal of Medical Virology 2013; 85: 1299-1306.
- Hansman GS, Katayama K and Maneekarn N: Genetic diversity of norovirus and sapovirus in hospitalized infants with sporadic cases of acute gastroenteritis in Chiang Mai, Thailand. Journal of Clinical Microbiology 2004; 42: 1305-07.
- Anbazhagi S, Kamatchiammal S and Santhosh DJ: Norovirus based viral gastroenteritis in Chennai city of southern India-An epidemiological study. Journal of General and Molecular Virology 2011; 3: 18-26.
- Menon VK, George S and Sarkar R: Norovirus gastroenteritis in a birth cohort in southern India. PloS one 2016; 11: e0157007.
- Reddy P, Shailaja V and Nagaraj GP: Prevalence of Norovirus and epidemiology of acute gastroenteritis in children.
- Chhabra P and Chitambar SD: Norovirus genotype IIb associated acute gastroenteritis in India. Journal of Clinical Virology 2008; 42: 429-32.
- Chhabra P, Dhongade RK and Kalrao VR: Epidemiological, clinical, and molecular features of norovirus infections in western India. Journal of Medical Virology 2009; 81: 922-32.
- Monica B, Ramani S and Banerjee I: Human caliciviruses in symptomatic and asymptomatic infections in children in Vellore, South India. Journal of Medical Virology 2007; 79: 544-51.
- Buesa J, Collado B and Lopez-Andujar P: Molecular epidemiology of caliciviruses causing outbreaks and sporadic cases of acute gastroenteritis in Spain. Journal of Clinical Microbiology 2002; 40: 2854-59.
- Wu X, Han J and Chen L: Prevalence and genetic diversity of noroviruses in adults with acute gastroenteritis in Huzhou, China, 2013–2014. Archives of Virology 2015; 160: 1705-13.
- Castilho JG, Munford V and Resque HR: Genetic diversity of norovirus among children with gastroenteritis in Sao Paulo State, Brazil. Journal of Clinical Microbiology 2006; 44: 3947-53.
- Arias C, Sala M and Dominguez A: Epidemiological and clinical features of norovirus gastroenteritis in outbreaks: a population-based study. Clinical Microbiology and Infection 2010; 16: 39-44.
- Lopman BA, Reacher MH and Vipond IB: Clinical manifestation of norovirus gastroenteritis in health care settings. Clinical Infectious Diseases 2004; 39: 318-24.
- Gupta S, Krishnan A and Sharma S: Changing pattern of prevalence, genetic diversity, and mixed infections of viruses associated with acute gastroenteritis in pediatric patients in New Delhi, India. Journal of Medical Virology 2018; 90: 469-76.
- Page N, Groome M and Nadan S: Norovirus epidemiology in South African children. Epidemiology & Infection 2017; 145: 1942-52.
- Alam MM, Khurshid A and Shaukat S: Viral etiologies of acute dehydrating gastroenteritis in Pakistani children: confounding role of parechoviruses. Viruses 2015; 7: 378-93.
- Rohra SN, Saxena VK and Vithalani NP: Molecular Study of Aetiology of Acute Gastroenteritis in Children of South Mumbai. Journal of Clinical & Diagnostic Research 2018; 12.
- Riddle MS and Walker RI: Status of vaccine research and development for norovirus. Vaccine 2016; 34: 2895-99.
How to cite this article:
Suman, Singh D, Tripathi R, Umrao J, Bhattacharya P, Ghoshal U and Dhole TN: Detection of human norovirus in acute gastroenteritis cases from north Indian pediatric population. Int J Pharm Sci & Res 2021; 12(1): 647-53. doi: 10.13040/IJPSR.0975-8232.12(1).647-53.
All © 2013 are reserved by the International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
72
647-653
734
1433
English
IJPSR
Suman, D. Singh, R. Tripathi, J. Umrao, P. Bhattacharya, U. Ghoshal and T. N. Dhole *
Department of Microbiology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, Uttar Pradesh, India.
tndhole@gmail.com
24 January 2020
25 April 2020
27 April 2020
10.13040/IJPSR.0975-8232.12(1).647-53
01 January 2021







