IDENTIFICATION OF AEROTOLERENCE GENE BATA AND BATB IN SUBGINGIVAL MICROFLORA: AGGREGATIBACTER ACTINOMYCETEMCOMITANS, TANNERELLA FORSYTHIA AND PREVOTELLA INTERMEDIA

IDENTIFICATION OF AEROTOLERENCE GENE BATA AND BATB IN SUBGINGIVAL MICROFLORA: AGGREGATIBACTER  ACTINOMYCETEMCOMITANS, TANNERELLA FORSYTHIA AND PREVOTELLA INTERMEDIA

1. Parthsarathy ¹, R. Gad ² and C. A. Jacob ^*3

Department  of  Periodontology,   SRM  Dental  College ¹,  Bharathi  Salai,  Ramapuram,  Chennai - 600089,  T. N.,  India.

Department of Biotechnology, SRM University ², Kattankullathur, Chennai - 603203, T. N., India.

Department of Periodontology,   Saveetha Dental College ³, Chennai- 600077, T. N., India.

ABSTRACT: Subgingival obligate anaerobes present within the biofilm such as Porphyromonas gingivalis, Tannerella forsythia, Prevotella intermedia and Aggregati bacter actinomycetemcomitans have been implicated in the initiation and progression of periodontal disease. Recent documentation has demonstrated that P.gingivalis is capable of maintaining its viability when exposed to oxidative stress by expressing Bat A and Bat B genes of the aerotolerance operon acting as virulence factors offering protection and further disease progression in the host. The present study aims to determine the presence of bat A and bat B genes in other periodontopathogenic species viz. Aggregatibacter actinomycetemcomitans, Tannerella forsythia and Prevotella intermedia, and the degree of homology using BLAST analysis

Dental plaque, obligate anaerobes, oxidative stress, bacteroides aerotolerance gene.

INTRODUCTION: Periodontitis is a polymicrobial, multifactorial infection that affects the tooth supported structures. The periodontal pocket formed as a result of the disease progression, provides a unique dynamic environment for the interaction and intercellular communication between the microbiota present and the host cells. ¹ The subtle shift from a gram positive aerobic microflora to a gram negative one teaming with facultative and obligative anaerobic species ^{2, 3} depends on factors such as temperature, pH, GCF flow and redox potential.⁴

Despite the heavy dependence on the afore-mentioned factors, characteristic bacterial diversity has been seen to exist where certain anaerobic species still manage to thrive in the initial biofilm formation. Li and co-workers ⁵ analyzed supragingival plaque over 6 hours of plaque formation. Their findings reported low levels of periodontal pathogens at the initial 4 hours of biofilm formation which included species like Tannerella forsythia, Porphyromonas gingivalis, Treponema denticola and Aggregatibacter actinomycetemcomitans.

These findings were further substantiated by Diaz and co-workers ⁶ confirming that anaerobic periodontopathogens can colonize early biofilms. This can be attributed to the apical shift of supragingival plaque as it progresses along the gingival sulcus resulting in ecological changes.⁷ The study of initial subgingival biofilm formation is more challenging due to the lack of models that mimic subgingival colonization or that allow appropriate sampling.⁸ Hence, it can only be hypothesized as to what factors are responsible for the survival of anaerobic periodontal pathogens in initial biofilm formation.

Kolenbrander and co-workers have proposed that coaggregation and close proximity facilitate bacterial mutualism, which in turn influences biofilm development. ⁸ Various metabolic interactions can occur at many levels and include nutritional exchange, environmental modification through oxygen detoxification, and small-molecule signal-mediated gene regulation. Though the symbiotic relationship between species might be part of the process that facilitates the survival of anaerobes in plaque, it is likely that there are many situations in which microorganisms are not protected by the overall oxygen metabolism of the microbial community.

In such scenarios, the survival of anaerobes will depend more upon defences against oxidative stress which are specific for each species. Oxidative stress response mechanisms could also be important during the bacterial invasion of host tissues, as a defense against oxygen-dependent killing of neutrophils and macrophages ⁹ and for survival in blood during bacteremias. In any of these roles, anti-oxidant defence systems are likely to contribute to the virulence of anaerobic microorganisms. The oxidative stress defences of anaerobes have not been widely studied. In contrast to the vast knowledge on anti-oxidant mechanisms operating in aerobes or facultative species, the mechanisms by which obligate anaerobes tolerate oxygen are poorly understood.

It seems that anaerobes have common anti-oxidant defences with aerobes which are not expressed at high levels in anaerobes or they are not all present simultaneously in the same species. Moreover, the metabolism of anaerobes relies on metabolic schemes built around enzymes that react easily with oxygen such as NADH oxidase ^{10, 11} and superoxide dismutase (SOD). P. gingivalis also possesses an Oxy R protein ⁶, homologous to that present in many facultative and aerobic microorganisms. ¹² Anti-oxidant-relevant genes whose transcription depends on Oxy R have been identified which include genes for SOD, Dps (a nonspecific, protective, DNA-binding protein), tpx (thiol peroxidise), alkylhydroperoxide reductase subunits F and C(ahpC-F operon) ¹³, rubrerythrin ¹⁴, ferritin ¹⁵  a heme layer that acts as an oxidative sink to eliminate the effects of hydrogen peroxide and other reactive oxygen species, thus protecting the cell membrane and other cellular components of the organism from oxidative damage.¹⁶

It seems then that although anaerobes, such as P. gingivalis, cannot survive highly oxygenated conditions, their own array of anti-oxidant defenses, plus the interaction with neighbouring facultative or aerobic bacterial species, allows them to adapt to oral biofilms. One proposed mechanism is that of aerotolerance, which allows anaerobes to survive in conditions of oxidative stress, although it does not imply that cell replication can occur under aerated conditions. An extensively studied example is that of P. gingivalis, which is able to survive under oxidative stress for several hours until the environment reverts to being anaerobic and cell division and growth are re-initiated.¹⁵

In P.gingivalis, the Aerotolerance gene A cluster of genes (PG1582 to PG1586) have been identified, bearing a very similar likeness to the previously described aerotolerance operon of Bacterioides fragilis.¹⁷ This operon includes :  PG1582 – Bat A, PG1583 – Bat B, PG1584 – Bat C, PG1585 – Bat D and PG1586 – Bat E which promote the survival of B. fragilis upon exposure to oxygen. Their presence in P. gingivalis suggests that this system may also ensure tolerance to oxygen in the oral cavity.¹⁸ Research based on this operon appears to substantiate the role of Bat A and Bat B proteins in promoting the survival of P.gingivalis during oxidative stress.  Therefore, it can be postulated that a similar set of genes may be present amongst other periodontopathogenic anaerobes present in mature plaque biofilm.

As the role of Prevotella intermedia have been well established in chronic periodontitis ^{5, 6} and the literature search revealed no data on the presence and influence of the Bat A and Bat B genes in P.intermedia, the present study was carried out as an attempt to investigate the presence of aerotolerance genes Bat A and Bat B in P. intermedia.

MATERIALS AND METHODS:

Sample Collection:

25 systemically healthy patients between 18 –35 years with different stages of periodontitis who attended the Department of Periodontics, SRM Dental College, Ramapuram, Chennai, India for various dental concerns were evaluated. Inclusion criteria for subjects with periodontitis were 20 or more natural teeth with 4 or more sites having ≥4mm probing pocket depth and clinical attachment loss. Subgingival plaque samples were collected from the deepest periodontal pockets of each subject with sterile curettes and immediately transferred to 1.5ml of reduced transport fluid for cultivation under anaerobic conditions within 4 hours of sampling.

Bacterial Culture:

Samples were vortexed for 2 minutes and split. 100µl each of the plaque sample was used for culture by digest buffer solution and PCR. 100 µl dilutions were placed on anaerobic blood agar plates (Hi-Media, India) supplemented with sheep blood (5% vol/vol), hemin (5 mg/liter), and menadione (1mg/liter) and incubated in 80% N₂ –10% H₂ –10% CO₂ at 37°C for 7 to 14 days. Different colonies developed were isolated and subcultured under standard anaerobic conditions as mentioned above for 1 week. Prevotella intermedia was grown in Todd Hewitt Broth; supplemented with beef heart, peptic digest of animal tissue, dextrose, sodium chloride, disodium phosphate, sodium carbonate for pH = 7.8(+/- 0.2).

PCR detection of the 16S rRNA gene:

16S rRNA genes of the periodontal pathogens P.gingivalis and P.intermedia were identified in plaque samples by PCR using gene specific primers.

Extraction of total genomic DNA from plaque samples:

Extraction of total genomic DNA from plaque samples was performed based on the technique elaborated by Sambrook et al 1989. The pellet was washed in 70% ethanol, air-dried and resuspended in TE-buffer and stored at -20ºC for further use. The purity of DNA was determined by UV spectrophotometric analysis at 260nm-280nm and separated by agaraose gel electrophoresis.

PCR of Plaque Sample:

The PCR temperature profile included an initial denaturation step at 94˚C for 5 minutes, followed for 30 cycles of a denaturation step at a 94’c for 1 minute; a primer-annealing step at 50˚C for 2 mins; an extention step at 72˚C for 3 minutes, and a final step at 72˚C for 7 minutes, temperature at hold is 4˚C. The amplicons were stored at –20˚C. Amplicons were analysed by 1% agaraose gel Electrophoresis performed in TAE buffer.

DNA Isolation:

DNA from bacterial pellets were isolated using Medox Easy® genomic DNA preparation kit (Medox Biotech India Pvt, Ltd.) according to manufacturer’s instructions and DNA was run in 0.7% agaraose gel electrophoresis and viewed by UV-transilluminator.

RESULTS:

FIG. 1.A                     FIG. 1.B                      FIG. 1.C

FIG 1.A) PCR amplification of16s rRNA genes: Lane 1: P. gingivalis, Lane 2: A.actinomycetemcomitans, Lane 3 : P. intermedia. FIG 1.B) 1% Agarose gel electrophoresis analysis of PCR amplified Bat A gene from the genomic DNA of A. actinomycetemcomitans and P.intermedia : Lane M - 1000 bp DNA ladder (molecular marker), Lanes 1 - PCR amplified products  of Bat A gene approximately 1050 bp for  DNA from P. gingivalis. (Positive control), Lane 2 to 3      - PCR amplified products of Bat A gene  approximately 1050 bp for DNA from A. actinomycetemcomitans, Lane 4 to 5- PCR amplified products of Bat A gene  approximately 1050 bp  for DNA from P. intermedia. FIG 1.C) 1% agarose gel electrophoresis analysis of PCR amplified Bat B gene from the genomic DNA of P. intermedia and A.a, Lane M – 500 bp DNA ladder (molecular marker),  Lanes 1- PCR amplified products of Bat B gene approximately 880 bp for DNA from P. gingivalis. (Positive control), Lane 2 to 3       - PCR amplified products of Bat B gene approximately 880 bp for DNA from Aac, Lane 4 - PCR amplified products of Bat B gene approximately 880 bp for DNA from P. intermedia

In Silico Technique:

FIG.2: A) NUCLEOTIDE SEQUENCES OF THE BAT A GENE IN PREVOTELLA INTERMEDIA:

5’atatcctgaattgctttggctgctgatcctgctgcctttgatagcgacttggtatatcctgcaagcacgtaagacttcggcaacgatgaccatatcttcattgaagccctttgaaggaagtcgccgaggtttgagggtctatctgcgccattcgttgccgatattgagagctctttcggtcggttttctcattattgctttggctcgtccgcagaataccaatagctggcagaaagattcgatcgagggcatagatattatgttggccatggatgtgtcaggcagtatgcaggccatggacttcaagccgaatcgcttggaggcagccaaagatgtagcgatttcctttatcaacaatcgtccgaacgacaatatcgggatggttacattcgccggagagagctttactcaatgtccattgactaccgaccataccgtattgcttaatatggtacaggacttgcagatgggtgttctggatgatggtacagctatcggaatgggattggctacggccgtcaatcgactgaaggacagcaaagccaagagccgcgtggttattctgctgacggacggatcaaacaacatgggcgacatcacaccccgaatggcagccgatattgccagaacgttcggtattcgtgtgtacacagtcggtgtaggcacacgaggagaagctcctttccccattcagacggaattcggagttggattcagaatgtgcctgtcgatatagacgaacccacattggacggaattgccgaggtatcgggtggaaaatacttcagggctgtcgataatgaaacgctgaatgaaatctacaaggaaatcgacaaattggagaagacgagacttatgaccaagagcttcaaggcttatgaggaaaaatactttgtctatgcccttattgcttttctcttgttgctgacagagtttttgcttcgcaatacact 3’

 BLASTX

FIG.2: B) NUCLEOTIDE SEQUENCE OF THE BAT B GENE IN PREVOTELLA INTERMEDIA

5’attcacccgaatacttatacttactgctgctgctcccattgcttgtgggtaggcgtctatgcttatcgcaaaagacgggcgcaagaaagacggtttgccgaacttccgctgctaaaggctctcaaaccggaagcaagtaccaaacgtcggatctggcgcaacggatttcttcttcttgccatcgttttcttgatcgggatgcttgcccgtccgcaaataagtattgtgtggatgtgcctaaagaggagaaaggtatcgaggctatgatttgtttggatatttccaactccatgctctgtgaagatgtcaagcccaatcgtttgagttttgccaagcaagtgttgggaaagctctttgacggcttgcagaacgacaaggttggattggttgtattcgcaggtaattatacgcaaataccgattactacggatttgtctgcagccaaacagtttcttgcagatataagtcccaatatggttacagcccaaggaacggctatcggagcggctatcgaacttgccccaaatctttttccgataataaggaaatcggtaagactatcattgtcctgacggatggagaaaatcatgaaggaaatgccatcgaagcggcacagcaagcccatgaagcaggcatacgggtcaatgttattggtctcggaacagccttgggggcacctatacctattgaagaaggatacctcaaagatgaaacgggcaatcctgtcgttaccaaattcgacgaaaagatgtgccgtgacattgcttcagcaggagagggtactttcttttccggacagagtgcttctgcgctggttcgggctatagagagccagctggacaaactccccaaagccgtactttcatcttcgtcttcttccggctatcgcgaagtgtacggatggttcggacttgcggctttgatatgtttattgttggaatcctgattcaggagcggaagagtaggttcttcagtaggat3’               

Clustal W:

Using the BLAST results, the highly similar sequences were grouped together and the family of proteins, to which the query protein belongs to, was determined using Clustal W. (Sequence data not included). Based on the dendrograms obtained from the Clustal W result, the family of the Bat A and Bat B genes were predicted and the related sequences were analysed. The relationship of the Bat A and Bat B genes with other species predicts the family, sub family and the function of the protein sequence that can be obtained from the gene

FIG 3.A): CLUSTAL W DENDROGRAM FOR BAT A. UNROOTED TREE (GENERATED BY PHYLIP'S DRAWTREE) B)        ROOTED TREE (GENERATED BY PHYLIP'S DRAWGRAM FOR BAT A). C) CLUSTAL W DENDROGRAM FOR BAT B. UNROOTED TREE (GENERATED BY PHYLIP'S DRAWTREE) D) ROOTED TREE (GENERATED BY PHYLIP'S DRAWGRAM FOR BAT B).

Homology Modeling:

FIG 4.A) LOADING OF RAW SEQUENCE (QUERY), b) LOADING OF TEMPLATE SEQUENCE (PDB TEMPLATE), c) FITTING OF THE RAW SEQUENCE WITH THE TEMPLATE STRUCTURE, d) RC PLOT BEFORE LOOP BUILDING: NON-PROLINE/ NON-GLYCINE RESIDUES PRESENT IN THE FORBIDDEN REGION: GLN53, LYS24, ASN11, ENERGY BEFORE EM =   -15371.639, e) RC PLOT AFTER LOOP BUILDING: Energy after EM =   -16322.033, f) SECONDARY STRUCTURE OF THE MODELED QUERY PROTEIN

DISCUSSION: Amongst the obligate anaerobic periodontal pathogens that have been implicated in the initiation and progression of periodontal disease, Porphromonas gingivalis has been documented in detail. ^{5, 6} Although strictly anaerobic, P.gingivalis is able to survive in the presence of atmospheric oxygen. ³⁰ The ability of anaerobes to survive oxidative stress is referred to as aerotolerance. ⁸

A variety of genes that are expressed during oxidative stress including those regulated by the Oxy R operon: sod, ahp C and ahp F; dps and usp A have been documented in the literature. ^{31, 32} With regard to the detail in which the afore-mentioned genes have been studied, few studies have documented the role of the Bat I operon. ^{18, 32, 33} Furthermore, in comparison to the extensive research performed on the aerotolerance mechanisms maintained by Porphromonas gingivalis, data pertaining to the regulation of oxidative stress control in Prevotella intermedia, another member of the Bacteroides species, appear to be limited. Extensive documentation has implicated Prevotella intermedia in the severity and progression of periodontal disease. ³⁴ However, the mechanisms to overcome oxidative stress in these microrganisms are poorly understood.

This study was aimed at identifying the presence of the bacteroides aerotolerance genes Bat A and Bat B in Prevotella intermedia and evaluating the degree of homology between these genes if present with that of previously documented Bat A and Bat B genes of P.gingivalis. The Bat A and Bat B genes were chosen from among the Bat l operon as they were the most frequently identified genes in the literature.^{17, 18, 21} The present study identified the Bat A and Bat B genes responsible for the unlimited growth of Prevotella intermedia in aerobic conditions by adapting the standardized PCR protocol. The amplified products of PCR were sequenced by di-deoxynucleotide technique while the in silico study was carried out with the sequence obtained. Different bioinformatics tools were used to carry out the functional analysis of the gene.

The sequence was analysed using the BLAST X tool and the protein hits obtained were used for multiple sequence alignment to trace out the phylogenetic relationships between the sequences by CLUSTALW tool. The BLAST X results for the Bat A and Bat B query sequence had 152 and 127 protein sequence hits respectively when compared with various protein databases. The first 4 hits in both queries showed much similarity to the query sequence, and thus studied to identify phylogenetic relationships.

The results obtained from the in silico studies revealed that the Bat A and Bat B genes translated into the bat A and bat B protein respectively; where bat A was seen to be involved in transcription regulation and bat B in the immune response activity. The structure of the bat A was also predicted using a homology modelling technique with the beta sheet denoted in yellow and the alpha helix of the protein denoted in red. The above mentioned results therefore, demonstrate the existence of the Bat A and Bat B genes in Prevotella intermedia, thus contributing to its survival in conditions of oxidative stress as an inherent virulence factor.

CONCLUSION: From the results of the present study, it may be proposed that the identification of the Bat A and Bat B genes in Prevotella intermedia conferring protection solely or in combination with other aerotolerant mechanisms for this bacteria to survive within the periodontal pocket when exposed to varying amounts of oxygen and during the host inflammatory response. Future directions could incorporate the use of the hypothetical protein model obtained to developing a treatment strategy against periodontal disease by host modulation or recombinant therapy. However, further documentation is warranted on the role these genes play and their clinical significance.

REFERENCES:

1. Lamont RJ and Jenkinson HF. Subgingival colonization by Porphyromonas gingivalis. Oral Microbiol. Immunol2000. 15:341–349.
2. Loe H, Theilade E, Jensen SB. Experimental gingivitis in man. J Periodontol 1965: 36: 177–187
3. Theilade E, Wright WH, Jensen SB, Lo¨e H. Experimental gingivitis in man. II. A longitudinal clinical and bacteriological investigation. J Periodontal Res 1966: 1:1–13.
4. Marsh PD. Sugar, fluoride, pH and microbial homeostasis in dental plaque. Proc Finn Dent Soc 1991; 87(4):515-25.
5. Li J, Helmerhorst EJ, Leone CW, Troxler RF, Yaskell T, Haffajee AD, Socransky SS, Oppenheim FG. Identification of early microbial colonizers in human dental biofilm. J Appl Microbiol 2004: 97: 1311–1318.
6. Diaz PI, Chalmers NI, Rickard AH, Kong C, Milburn CL, Palmer RJ Jr, Kolenbrander PE. Molecular characterization of subject-specific oral microflora during initial colonization of enamel. Appl Environ Microbiol 2006: 72: 2837–2842.
7. Theilade E, Theilade J. Formation and ecology of plaque at different locations in the mouth. Scand J Dent Res 1985: 93: 90–95.
8. Kolenbrander PE, Palmer Jr RJ, Rickard AH, Jakubovics NS, Chalmers NI and Diaz PI. Bacterial interactions and successions during plaque development. Periodontology 2000, Vol. 42, 2006, 47–79
9. Chapple ILC. Role of free radicals and antioxidants in the pathogenesis of inflammatory periodontal disease. J Clin Pathol Mol Pathol. 1996; 49:247-255
10. Caldwell CE, Marquis RE. Oxygen metabolism by Treponema denticola. Oral Microbiol Immunol 1999: 14: 66–72.
11. Diaz PI, Zilm PS, Rogers AH. The response to oxidative stress of Fusobacterium nucleatum grown in continuous culture. FEMS Microbiol Lett 2000: 187: 31–34.
12. Stanton TB, Jensen NS. Purification and characterization of NADH oxidase from Serpulina (Treponema) hyodysenteriae. J Bacteriol 1993: 175: 2980–2987.
13. Meuric V, Gracieux P, Tamanai-Shacoori Z, Perez-Chaparro J, Bonnaure-Mallet M. Expression patterns of genes induced by oxidative stress in Porphyromonas gingivalis. Oral Microbiol Immunol 2008: 23: 308–314.
14. Sztukowska M, Bugno M, Potempa J, Travis J and Kurtz DM Jr. Role of rubrerythrin in the oxidative stress response of Porphyromonas gingivalis. Mol. Microbiol.2002; 44:479–488
15. Diaz PI, Slakeski N, Reynolds EC, Morona R, Rogers AH and Kolenbrander PE. Role of oxyR in the Oral Anaerobe Porphyromonas gingivalis. Journal of Bacteriology.2006; 188(7): 2454–2462
16. Smalley JW, Birss AJ and Silver J. The periodontal pathogen Porphyromonas gingivalis harnesses the chemistry of the mu-oxo bishaem of iron protoporphyrin IX to protect against hydrogen peroxide. FEMS Microbiol. Lett. 183:159–164.
17. Tang, Y. P., M. M. Dallas, and M. H. Malamy. Characterization of the Batl (Bacteroides aerotolerance) operon in Bacteroides fragilis: isolation of a fragilis mutant with reduced aerotolerance and impaired growth in in vivo model systems. Mol. Microbiol.1999; 32:139–149.
18. Nelson KE, Fleischmann RD, DeBoy RT et al. Complete Genome Sequence of the Oral Pathogenic Bacterium Porphyromonas gingivalis Strain W83. Journal of Bacteriology, Sept. 2003, p. 5591–5601
19. Marquis RE. Oxygen metabolism, oxidative stress and acid-base physiology of dental plaque biofilms. J Ind Microbiol. 1995 Sep; 15(3): 198-207.
20. Mettraux GR, Gusberti FA, Graf H. Oxygen tension (pO2) in untreated human periodontal pockets. J Periodontol. 1984 Sep; 55(9):516-21.
21. Kenney EB, Ash MM Jr. Oxidation reduction potential of developing plaque, periodontal pockets and gingival sulci. J Periodontol. 1969 Nov; 40(11):630-3.
22. Massol-Deya AA, Whallon J, Hickey RF and Tiedje JM. Biofilm architecture: a fortuitous engineering feature. 1994 ASM News 60(8): 406.
23. Katsuragi H, Ohtake M, Kurasawa I, Saito K. Intracellular production and extracellular release of oxygen radicals by PMNs and oxidative stress on PMNs during phagocytosis of periodontopathic bacteria. Odontology 2003 Sep; 91(1):13–18.
24. Brawn K, Fridovich I. DNA strand scission by enzymically generated oxygen radicals. Arch Biochem Biophys. 1981 Feb; 206(2): 414-19.
25. Harley JB, Flaks JG, Goldfine H, Bayer ME, Rasmussen H. Hyperbaric oxygen toxicity and ribosome destruction in Escherichia coli Can J Microbiol. 1981 Jan; 27(1): 44-51.
26. Rocha ER, Smith CJ. Oxidative stress response in an anaerobe, Bacteroides fragilis: a role for catalase in protection against hydrogen peroxide. J Bacteriol 1996 Dec; 178: 6895-6903.
27. Zheng M, Storz G. Mechanisms for sensing and responding to oxygen deprivation. In Bacterial Stress Responses ed. Storz G and Hengge-Aronis R. Washington, DC: American Society for Microbiology; 2000. pp. 47–59.
28. Lynch M, Kuramitsu H. Expression and role of superoxide dismutases (SOD) in pathogenic bacteria. Microbes Infect 2000 Aug; 2(10): 1245–1255.
29. Park MK, Myers RA, Marzella L. Oxygen tensions and infections: modulation of microbial growth, activity of antimicrobial agents, and immunologic responses. Clin Infect Dis. 1992 Mar; 14(3): 720-40.
30. Tally FP, Stewart PR, Sutter VL, Rosenblatt JE. Oxygen tolerance of fresh clinical anaerobic bacteria. J Clin Microbiol. 1975 Feb; 1(2): 161-4.
31. UeshimaJ, Shoji M, Ratnayake DB, Abe K, Yoshida S, Yamamoto K, Nakayama K. Purification, gene cloning, gene expression, and mutants of Dps from the obligate anaerobe Porphyromonas gingivalis. Infect Immun. 2003 Mar; 71(3):1170-8.
32. Watanabe T, Maruyama F, Nozawa T et al. Complete Genome Sequence of the Bacterium Porphyromonas gingivalis TDC60, Which Causes Periodontal Disease. J Bacteriol, 2011 Aug; 193(16): 4259–60.
33. Naito M, Hirakawa H, Yamashita A, et al. Determination of the Genome Sequence of Porphyromonas gingivalis Strain ATCC 33277 and Genomic Comparison with Strain W83 Revealed Extensive Genome Rearrangements in P. gingivalis. DNA Res 2008 Aug; 15(4): 215–25.
34. SlotsJ, Listgarten  Bacteroides gingivalis, Bacteroides intermedius and Actinobacillus actinomycetemcomitans in human periodontal diseases. J Clin Periodontol. 1988 Feb; 15(2):85-93. Review.
    

    ---

    How to cite this article:

    Parthsarathy H, Gad MR and Jacob CA: Identification of Aerotolerence Gene Bat A and Bat B in Subgingival Microflora: Aggregatibacter Actinomycetemcomitans, Tannerella Forsythia and Prevotella Intermedia. Int J Pharm Sci Res 2016; 7(2): 689-96.doi: 10.13040/IJPSR.0975-8232.7(2).689-96.

    ---

    All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.

    ---