MOLECULAR SCREENING FOR PREVALENCE OF ANTIBIOTIC-RESISTANT SALMONELLA SPP. IN DRINKING WATER SAMPLES FROM SLUM AREAS OF BHOPAL CITY, INDIA
HTML Full TextMOLECULAR SCREENING FOR PREVALENCE OF ANTIBIOTIC-RESISTANT SALMONELLA SPP. IN DRINKING WATER SAMPLES FROM SLUM AREAS OF BHOPAL CITY, INDIA
Priyanka Singh, Nitish Rathore, Priyavanda Tenguria, Rajnandani Katariya and Mayank Tenguria *
Biopharmaceutical & Biomedical Division, Lenience Biotech Lab, Bhopal, Madhya Pradesh, India.
ABSTRACT: The incidence of multiple antibiotic-resistant Salmonella spp. isolates in randomly collected potable water samples from 70 different slum area sites of Bhopal City, M. P. India, were investigated through a molecular approach.BSA media was used for isolation and CFU count of Salmonella spp. The DNA of representative Salmonella spp. Colors of each water sample were subjected to PCR to detect Amp, cmlA and tetA genes with standard PCR protocol with annealing at primers specific temperature for 1 minute 30 seconds. The presence of the target gene in the PCR product was detected on 1% agarose gel. An in-vitro antibiogram study was done to check the phenotypic antibiotic resistance. A total 74.29% of samples were reported to have a prevalence of Salmonella spp. with 44.19average CFU count and huge standard deviation (σ=28.28). Incidence of Amp, cmlA, and tetA genes is reported to be 67.31%, 36.54%, and 61.54% in Salmonella spp. Isolates from 52 samples which doesn’t coincide with the phenotypic prevalence of antibiotic resistance. 25, 17, and 11isolates showed resistance towards tetracycline, ampicillin, and chloramphenicol, respectively. The prevalence of phenotypic resistance towards ampicillin and incidence of amp gene in isolates were significant as the p < .05 in the case, contrarily chloramphenicol and tetracycline weren’t significant for the incidence of their respective genes cmlA and tetA since their p-values are not significant at p < .05. However, the prevalence of phenotypic resistance towards chloramphenicol and tetracycline was independent of incidence of their respective genes in isolates is a matter of further extensive investigation on responsible factors thus increasing the residence time of drug with better patient compliance.
Keywords: Antibiotic resistance gene, Clinical diagnosis, Molecular screening, Public health
INTRODUCTION: Water is the most studied hydrogen chalcogenide regarded as a "universal solvent which is transparent, colourless, tasteless, odourless, fluid and is one of the essential components on earth containing minerals important for all the organism on the surface of earth and
crucial for the existence of humans since this vital natural resource is used for drinking, irrigation, industrial applications, fisheries, electricity production, etc., 1, 2. But many people do not have access to clean and safe drinking water and many die of water-borne bacterial infections 3.
Water is unsafe for human consumption when it is contaminated with pathogenic microorganisms, and satisfactory quality of water supply should be guaranteed for all. Water-borne diseases, including diarrhea, cholera, typhoid fever and dysentery, have been predominantly ascribed to perilous water and unhygienic practices 4.
People from developing countries encountered a higher risk of water-borne diseases compared to developed countries 5. The contamination of water with infected fecal material is common in areas with poor standards of hygiene and sanitation, which makes the microbiological quality assessment essential 6. Salmonella is a most momentous pathogenic bacterium causing typhoid and non-typhoidal Salmonellosis. Salmonella species are most often cause of foodborne ailment in both animals and humans, resulting 93.8 million approx. Cases cause globally per year 7, 8 whereas in developing countries like India, foodborne diseases are for the most part under announced; anyway, in the previous 29 years (1980-2009) 3485 people have been influenced from 37 Salmonella related episodes 9. Salmonella transmission generally happens due to contaminated food and water consumption 10, 11, 12.
Salmonella contaminations are clustered into clinical classifications: Salmonellosis, gastroenteritis, bacteremia, osteomyelitis, reactive arthritis, enteric fever and food poisoning 13, 14, 15.
Salmonella disease in individuals is essentially achieved about by drinking water contaminated with discharges and defecation of contaminated faunae 11, 16, 17, 18. According to Seas et al., children under 5 years of age, primarily in Asian and African countries, are seen as a gigantic gathering of patients contaminated with water-borne microbial infection 19. Drinking water containing antibiotic-resistant bacterial strains is a serious concern according to scientific literature 20. Due to resistant microorganisms' increasing pervasiveness, antibacterial therapies have become challenging to a large extent 21, 22, 23. In view of the facts mentioned the present investigation was intended to detect the prevalence of multiple antibiotic-resistant Salmonella spp. Isolates compared to the incidence of antibiotic resistance gene through molecular approach in drinking water samples collected from some of the slum areas of Bhopal City, M.P. India.
MATERIALS & METHODS: Drinking water samples from Bhopal City were randomly collected from different slum areas of Bhopal. 50ml of water samples were collected from the 70 sites in clean, dry, and sterile containers using an aseptic condition used for screening Salmonella spp. during the period of October 2020 to March 2021.
Screening and CFU Count of Salmonella spp: Bismuth Sulphite Agar Media (HiMedia Laboratories India Pvt Ltd) was used for selective screening and isolation of Salmonella spp. Following aseptic procedures, 0.1 ml of serially diluted water from each collected sample were subjected to screen CFUs of Salmonella spp. by spread plate techniques aseptically, which were incubated at 37oC for 24 h. The development of Jet black, convex-type colonies surrounded by metallic sheen indicates colony-forming units (CFUs) Salmonella spp. To have the idea of contamination on a quantitative basis following formulae for CFU count were used;
CFU per ml = No. of CFU /Total Vol. Plated ×Dilution factor
Confirmation of Antibiotic Resistance: The representative CFUs of Salmonellaspp from each plate were randomly picked up and cultured in nutrient broth used for both molecular detection of antibiotic-resistant genes and in-vitro antibiotic susceptibility assays.
DNA Extraction: The conventional boiling method extracted total genomic DNA from randomly picked representative colonies of Salmonella spp. on BSA media plates. To a 1.5 ml microfuge tube containing 1 ml of nutrient broth was inoculated with 1 randomly picked colonies from each water sample were transferred and incubated for 24 hours at 37oC.
After which, each tube was centrifuged at 10000 rpm for 7 minutes then the supernatant was discarded, and the pellet so obtained was washed with 500 µl of sterile distilled water and then centrifuged at 12000 rpm for 5 min.
Discarding the supernatant again and the retained pellet was homogenized with 200 µL of sterile distilled water subjected to heating in a boiling digital water bath at 100°C (Navyug, India) for 10 min was allowed to cool for 7 min in an ice bath. The microfuges were then centrifuged at 10000 rpm for 5 min. The obtained supernatants were then retained in fresh sterile 1.5 ml microfuges and stored at 20°C for further use.
Detection of Antibiotic-Resistant Genes: With the primer-specific PCR approach, the total genomic DNA samples from representative colonies of Salmonellas spp. were subjected to screening for genes encoding resistance to Ampicillin, Chloramphenicol, and Tetracycline. Previously reported primer sequences were used for this purpose, whose sequence details & annealing conditions are mentioned in Table 1.
The PCR reaction was performed in 25 μl volume, which contains 12.5 μl PCR TaqMixture (HiMedia, India), 0.5 μl each of forward and reverse primers (Bioserve Biotechnologies, India) 5 μl template DNA and 6.5 μl molecular grade distilled water (HiMedia). The Sterile distilled water was used in place of DNA as a negative control in one tube. The PCR was performed on Prima 96 Thermocycler (HiMedia, India) with PCR conditions having initial denaturation for 5 min at 94°C, followed by 30 cycles of denaturation 94°C for 30 seconds, annealing at primers specific temperature for 1 min 30 seconds and extension at 72°C for 1 min and final extension at 72°C for 10 minutes.
The PCR product was subjected to electrophoresis on 1% Agarose gel in 1X TAE buffer running at 100 volts for 30 minutes. Then the presence of target antibiotic-resistant genes in the form of a band on the gel was confirmed by viewing the gel on a UV transilluminator (Thomas Baker Biosciences, India).
TABLE 1: LIST OF PRIMER SETS USED FOR THE DETECTION OF ANTIBIOTIC RESISTANCE GENE IN SALMONELLA SPP. ISOLATED FROM WATER SAMPLES IN SINGLEX PCR
| S. no. | Antibiotic | Target Gene | Primer Sequences | Annealing Temp. |
| 1. | Ampicillin 24, 25 | Amp | Forward: ATGCACACGCTGATCGGATT
Reverse: GCGGACGCAGACTTCACTAA |
65oC |
| 2. | Chloramphenicol 26, 27 | cmlA | Forwards: CCGCCACGGTGTTGTTGTTATC
Reverse: CACCTTGCCTGCCCATCATTAG |
58oC |
| 3. | Tetracycline 28, 27 | tetA | Forwards: GGTTCACTCGAACGACGTCA
Reverse: CTGTCCGACAAGTTGCATGA |
56oC |
Phenotypic Antibiotic Susceptibility: The in-vitro antibiogram study was done against isolated Salmonella spp. was done on nutrient agar media according to the earlier described methods 29, 30. The overnight broth culture of Salmonella spp. Isolates were suitable maintained at McFarland 0.5 standard and inoculated onto the nutrient agar media plates using sterile cotton swab.
Antibiotic octadisc *G-XXI-minus (HiMedia, India) containing the discs of common antibiotics Chloramphenicol (30 µg), Ampicillin (10 µg), Tetracycline (30 µg), Gentamicin (10 µg), Co-Trimoxazole (25 µg), Ceftriaxone (30 µg), Cefuroxime (30 µg) and Ciprofloxacin (5 µg) was used for antibiotic susceptibility assay against the Salmonella spp. As an indication of sensitivity or resistance towards the particular drug, the zone of inhibition or no zone was recorded after 24 hours of incubation at 37oC.
RESULTS:
Prevalence of Salmonella spp: Out of 70 different drinking water samples randomly collected from slum areas of Bhopal City, 74.29% samples were reported to have prevalence of Salmonella spp. on bismuth sulphite agar media. Only 52 out of 70 water samples were reported to be contaminated with Salmonella spp.
At a dilution of 10–7 the averages CFU count of Salmonella spp. in all the 52 water samples lies in the range of 44.19 with a huge standard deviation (σ=28.28) which describes an ambiguous level of contamination in sample drinking waters taken from slum areas Table 2.
Detection of Antibiotic Resistant Gene: The most representative Salmonella spp. isolates out of the 52 water samples showing growth on culture plates when subjected for detection of three antibiotic resistance genes namely Amp, cmlA and tetA, their incidence is reported to be 67.31%, 36.54% and 61.54% respectively, indicates that the incidence of chloramphenicol resistance gene is reported to be highest among the tested isolates followed by tetracycline and ampicillin resistance gene Table 2. But the percentage incidence doesn’t coincide the phenotypic prevalence of antibiotic resistance among the same Salmonella spp. isolates.
TABLE 2: CFU COUNT OF SALMONELLA SPP. ISOLATES ON BSA MEDIA OUT OF 52 POSITIVE DRINKING WATER SAMPLES AND ANTIBIOTIC RESISTANCE GENE DETECTED IN REPRESENTATIVE SALMONELLA SPP. COLONY OF WATER SAMPLES
| S. no. | Sample Code | CFU count 10–7 dilution | Target gene detected in the representative colony | ||
| Amp | cmlA | tetA | |||
| 1 | S-1 | 24 | 1 | 1 | 1 |
| 2 | S-2 | 12 | 1 | 0 | 1 |
| 3 | S-3 | 36 | 0 | 0 | 1 |
| 4 | S-4 | 54 | 1 | 0 | 0 |
| 5 | S-6 | 78 | 1 | 1 | 1 |
| 6 | S-7 | 11 | 1 | 1 | 0 |
| 7 | S-8 | 36 | 1 | 0 | 1 |
| 8 | S-10 | 45 | 1 | 1 | 1 |
| 9 | S-11 | 23 | 0 | 1 | 0 |
| 10 | S-12 | 29 | 0 | 1 | 0 |
| 11 | S-14 | 78 | 1 | 0 | 1 |
| 12 | S-15 | 36 | 1 | 0 | 1 |
| 13 | S-16 | 14 | 1 | 1 | 0 |
| 14 | S-18 | 37 | 1 | 0 | 1 |
| 15 | S-19 | 61 | 0 | 1 | 1 |
| 16 | S-20 | 29 | 0 | 0 | 1 |
| 17 | S-21 | 35 | 1 | 1 | 0 |
| 18 | S-24 | 10 | 0 | 0 | 1 |
| 19 | S-26 | 47 | 1 | 0 | 1 |
| 20 | S-27 | 157 | 1 | 1 | 0 |
| 21 | S-28 | 36 | 1 | 0 | 1 |
| 22 | S-29 | 22 | 0 | 0 | 0 |
| 23 | S-30 | 59 | 1 | 1 | 0 |
| 24 | S-31 | 18 | 1 | 0 | 1 |
| 25 | S-33 | 44 | 0 | 0 | 1 |
| 26 | S-34 | 86 | 1 | 1 | 1 |
| 27 | S-36 | 36 | 1 | 0 | 0 |
| 28 | S-37 | 44 | 1 | 1 | 1 |
| 29 | S-38 | 25 | 0 | 0 | 0 |
| 30 | S-39 | 11 | 1 | 0 | 1 |
| 31 | S-40 | 33 | 0 | 0 | 1 |
| 32 | S-41 | 42 | 0 | 0 | 1 |
| 33 | S-44 | 45 | 1 | 1 | 0 |
| 34 | S-45 | 16 | 0 | 0 | 1 |
| 35 | S-47 | 22 | 1 | 0 | 0 |
| 36 | S-48 | 77 | 1 | 0 | 1 |
| 37 | S-49 | 39 | 1 | 1 | 0 |
| 38 | S-50 | 45 | 1 | 0 | 1 |
| 39 | S-51 | 08 | 0 | 1 | 1 |
| 40 | S-52 | 77 | 1 | 0 | 0 |
| 41 | S-54 | 84 | 0 | 1 | 0 |
| 42 | S-56 | 38 | 1 | 0 | 1 |
| 43 | S-57 | 79 | 1 | 0 | 1 |
| 44 | S-59 | 51 | 1 | 1 | 0 |
| 45 | S-61 | 105 | 1 | 0 | 1 |
| 46 | S-63 | 81 | 0 | 0 | 0 |
| 47 | S-64 | 41 | 1 | 1 | 0 |
| 48 | S-65 | 19 | 1 | 0 | 1 |
| 49 | S-66 | 27 | 1 | 0 | 1 |
| 50 | S-68 | 77 | 0 | 0 | 1 |
| 51 | S-69 | 18 | 0 | 0 | 0 |
| 52 | S-70 | 41 | 1 | 0 | 1 |
| Total Samples
= 52 |
Average CFU Count = 44.19SD or σ =28.28 | Total Incidences
= 35 |
Total Incidences
= 19 |
Total Incidences
= 32 |
|
Note: 1= presence of target gene and 0 = absence of target gene
In-vitro Antibiotic Susceptibility: In terms of phenotypic antibiotic susceptibility, out of 52 Salmonella spp. isolates of drinking water origin from slum areas, 25 isolates were reported to be resistant towards tetracycline, and 17 isolates were resistant to ampicillin, while 11 isolates were resistant to chloramphenicol. Referring to Table 3 all the 52 Salmonella spp. isolates were sensitive to gentamicin.
TABLE 3: IN-VITRO PHENOTYPIC ANTIBIOTIC SUSCEPTIBILITY PROFILE OF 52 SALMONELLA SPP. ISOLATES TOWARDS 8 ANTIBIOTICS USED
| S. no. | Antibiotics used | Percentage of sensitive isolates | Percentage of resistant isolates |
| 1 | Chloramphenicol | 78.8% | 21.2% |
| 2 | Ampicillin | 67.3% | 32.7% |
| 3 | Tetracycline | 51.9% | 48.1% |
| 4 | Gentamicin | 100% | 0.00% |
| 5 | Co-Trimoxazole | 90.4% | 09.6% |
| 6 | Ceftriaxone | 88.5% | 11.5% |
| 7 | Cefuroxime | 88.5% | 11.5% |
| 8 | Ciprofloxacin | 90.4% | 09.6% |
DISCUSSION: Polluted and contaminated drinking water is the source of several water-borne diseases due to the presence of various types of bacteria, viruses, protozoa, and helminthes 31, 32. Salmonellosis is supposed to cause a global economic impact as it stands as an imperative public health problem responsible for substantial morbidity and mortality 33 and water-borne Salmonella spp. becomes a serous menace when they are resistant to multiple antibiotics isolated 34. In terms of clinical diagnosis of microbial pathogens, the PCR-based investigation are fast, specific, sensitive and safe for detection of pathogens through culture methods are still popular and useful due to their simplicity and cost-effectiveness 33. However, in cases of detection of antibiotic-resistant bacteria, the isolates' genotypic and phenotypic profiles do not coincide mostly. Excessive and unauthorized use of antibiotics in the community imposes the emergence, and spread of antibiotic resistant bacteria strains in food and water that often leads to the failures of chemotherapies in pathological conditions 34, 35, 36. Because of the increasing concern towards antibiotic resistance for public health, the incidence of 3 antibiotic resistance genes and the prevalence of antibiotic-resistant Salmonella isolates was monitored. When we compared the actual prevalence of antibiotic resistance of indigenously isolated Salmonella spp. towards the ampicillin, chloramphenicol, and tetracycline antibiotics by antibiotic susceptibility assay to confirm the phenotypic resistance due to the incidence of Amp, clmA, and tetA gene within the test samples by ANOVA method (https://goodcalculators.com/one-way-anova-calculator/ and https://www.socscistatistics.com/tests/anova/default2.aspx), the prevalence of phenotypic resistance towards ampicillin and incidence of amp gene in samples isolates were observed to be significant as the p < .05 in the case Table 4. While the prevalence of phenotypic resistance towards chloramphenicol and tetracycline doesn’t observed to be significant for the incidence of their respective genes cmlA and tetA since their p-values are not significant at p < .05 Table 5, Table 6.
TABLE 4: SUMMARY OF ANOVA FOR COMPARISON AMONG PHENOTYPIC PREVALENCE OF AMPICILLIN RESISTANCE AND INCIDENCE OF AMP GENE IN SALMONELLA SPP. SAMPLES
| Data Summary | |||||||||
| Groups | N | Mean | Std. Dev. | Std. Error | |||||
| Prevalence of Phenotypic Resistance to Ampicillin | 52 | 0.3269 | 0.4737 | 0.0657 | |||||
| Incidence of Amp gene for Resistance | 52 | 0.6731 | 0.4737 | 0.0657 | |||||
| ANOVA Summary | |||||||||
| Source | Degrees of Freedom DF | Sum of Squares SS | Mean Square MS | F-Stat | P-Value | ||||
| Between Groups | 1 | 3.1162 | 3.1162 | 13.8874 | 0.0003 | ||||
| Within Groups | 102 | 22.888 | 0.2244 | ||||||
| Total | 103 | 26.0042 | |||||||
Note: The f-ratio value is 13.88571. The p-value is .000319. The result is significant at p < .05.
TABLE 5: SUMMARY OF ANOVA FOR COMPARISON AMONG PHENOTYPIC PREVALENCE OF CHLORAMPHENICOL RESISTANCE AND INCIDENCE OF CMLA GENE IN SALMONELLA SPP. SAMPLES
| Data Summary | ||||||
| Groups | N | Mean | Std. Dev. | Std. Error | ||
| Prevalence of Phenotypic Resistance to Chloramphenicol | 52 | 0.2115 | 0.4124 | 0.0572 | ||
| Incidence of cmlA gene for Resistance | 52 | 0.3654 | 0.4862 | 0.0674 | ||
| ANOVA Summary | ||||||
| Source | Degrees of Freedom DF | Sum of Squares SS | Mean Square MS |
F-Stat | P-Value | |
| Between Groups | 1 | 0.6158 | 0.6158 | 3.0301 | 0.0847 | |
| Within Groups | 102 | 20.7297 | 0.2032 | |||
| Total | 103 | 21.3455 | ||||
Note: The f-ratio value is 3.02783. The p-value is .084864. The result is not significant at p < .05.
TABLE 6: SUMMARY OF ANOVA FOR COMPARISON AMONG PHENOTYPIC PREVALENCE OF TETRACYCLINE RESISTANCE AND INCIDENCE OF TETA GENE IN SALMONELLA SPP. SAMPLES
| Data Summary | ||||||
| Groups | N | Mean | Std. Dev. | Std. Error | ||
| Prevalence of Phenotypic Resistance to Tetracycline | 52 | 0.4808 | 0.5045 | 0.07 | ||
| Incidence of tetA gene for Resistance | 52 | 0.6154 | 0.4913 | 0.0681 | ||
| ANOVA Summary | ||||||
| Source | Degrees of Freedom DF | Sum of Squares SS |
Mean Square MS |
F-Stat | P-Value | |
| Between Groups | 1 | 0.471 | 0.471 | 1.8998 | 0.1711 | |
| Within Groups | 102 | 25.2907 | 0.2479 | |||
| Total | 103 | 25.7617 | ||||
Note: The f-ratio value is 1.90038. The p-value is .171052. The result is not significant at p < .05.
CONCLUSIONS: In view of the experimental outcomes of the present investigation, the antibiotic resistance in any bacterial species happens due to the presence of antibiotic resistance genes, but the expression of this antibiotic resistance gene probably depends on several factors that are responsible for actual prevalence on antibiotic resistance in Salmonella spp.
In the present study, the prevalence of phenotypic antibiotic resistance was significant in the incidence of the ampicillin-resistant gene in Salmonella spp. isolates from drinking water samples however, the prevalence phenotypic resistance towards chloramphenicol and tetracycline antibiotics was independent of the incidence of their respective antibiotic-resistant genes in Salmonella spp. isolates from drinking water samples which is the matter of further extensive investigation on several other responsible factors.
Authors' Contribution: MT contributed to the conception, design, supervision, administration of the study, and writing the original version of the manuscript. All authors contributed their expertise in data acquisition, analysis, and manuscript revision.
Funding Statement: No funding available. The research work was supported by Lenience Biotech Lab, Bhopal, for laboratory facility and cost of experiments.
CONFLICTS OF INTEREST: All the authors confirm that they have no conflict of interest regarding the present work.
REFERENCES:
- Dirican S: Assessment of Water Quality Using Physico-Chemical Parameters of Çamlıgöze Dam Lake in Sivas, Turkey. Ecologia 2015; 5(1): 1-7.
- Dwivedi AP and Tripathi IP: Analysis of Physico-Chemical Characteristics of Surface Water Samples Collected from West Zone of Central India. International Journal of Advanced Research in Chemical Science 2016; 3(8): 24-33.
- Cabral JP: Water Microbiology. Bacterial Pathogens and Water. International Journal of Environmental Research and Public Health 2010; 7(10): 3657–3703.
- Mahmud ZH, Islam MS, Imran, KM Hakim, SAI, Worth M, Ahmed A, Hossan S, Haider M, Rafiqul-Islam M, Hossain F, Johnston D and Ahmed N: Occurrence of Escherichia coli and FaecalColiforms in Drinking Water at Source and Household Point-of-Use in Rohingya Camps, Bangladesh. Gut Pathogen 2019; 11: 52.
- Simpson JM, Santo Domingo JW and Reasoner DJ: Microbial Source Tracking, State of the Science. Environmental Science Technology 2002; 36: 5279-5288.
- Luksamijarulkul P, Pumsuwan V and Pungchitton S: Microbiological Quality of Drinking Water and using Water of a Chao Phya River Community, Bangkok. Southeast Asian J Trop Med Public Health 1994; 25(4): 633-637.
- Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’Brien SJ and Hoekstra RM: The Global Burden of Non-typhoidal Salmonella gastroenteritis. Clinical Infectious Diseases 2010; 50(6): 882-889.
- Gillespie BE, Mathew AG, Draughon FA, Jayarao BM and Oliver SP: Detection of Salmonella enterica Somatic Groups C1 and E1 by PCRenzyme-linked Immunosorbent Assay. Journal of Food Protection 2003; 66: 2367-2370.
- Sudershan RV, Kumar RN and Polasa K: Foodborne Diseases in India – A Review. British Food Journal 2012; 114(5): 661-680.
- D’Aoust JY: Salmonella. In: Doyle MP (Ed.), Foodborne Bacterial Pathogens. CRC Press 1989; 327–445.
- Quinn PJ, Markey BK, Carter ME, Donnelly WJ and Leonard FC: Veterinary Microbiology and Microbial Disease. Iowa State University Press, Ames, Iowa, USA 2002.
- Brooks GF, Carroll KC, Butel JS, Morse SA and Mietzner TA: Jawetz, Melnick and Adelberg's Medical Microbiology, 26 ed. McGraw-Hill Education. USA 2015.
- Owens MD and Warren DA: Salmonella Infection. Emedicine: Emergency Medicine Available from: http://www.emedicine.medscapecom/article/785774-overview.html. Accessed on 15-04-2015.2009
- Klotchko A and Wallace MR: Salmonellosis: Treatment and Medication. Available from: http://www. emedicine.medscape.com/article/228174-overview. Accessed on 15-04-2015.2009
- Pandit RK Gupta RD and Mukherjee TK: Identification of potential salmonella typhi beta-lactamase tem 1 inhibitors using peptidomimetics, virtual screening and molecular dynamics simulations. International Journal of Pharmacy and Pharmaceutical Sciences 2018; 10(1): 91-96.
- Zahraei ST: Salmonella. Tehran University Press, Tehran 2000.
- Winn W, Allen S, Janda W, Koneman E, Procop G, Schreckenberger P and Woods G: Koneman's Color Atlas and Textbook of Diagnostic Microbiology. Ed 6th Lippincott Williams and Wilkins 2006.
- Motlagh H, Tavakoli HR, Dabaghmoghadam A, Cheraghi N and Akbarin HA: Assessment of Bactaslide media in Diagnosis of Salmonella in Water and Foods in Comparison with Standard Method in Order to Use in Crisis. Annals of Military and Health Sciences Research 2013; 11: 114-119.
- Seas C, Alarcon M, Aragon JC, Beneit S, Quiñonez M, Guerra H and Gotuzzo E: Surveillance of Bacterial Pathogens Associated with Acute Diarrhea in Lima, Peru. International J of Infectious Diseases 2000; 4: 96–99.
- Ahirwar KK and Tenguria RK: Screening of Multidrug Resistant Salmonella spp from Potable Water Collected from the Slum Areas of Bhopal, M.P. India. International Journal of Current Microbiology and Applied Sciences 2020; 9(2): 409-415.
- Grabow WOK, Prozesky OW and Smith LS: Drug resistant coliforms call for review of water quality standards. Water Research 1974; 8:1-9.
- Hinshaw V, Punch J, Allison MJ and Dalton HP: Frequency of R-factor-Mediated Multiple Drug Resistance in Klebsiella and Aerobacter. Applied and Environmental Microbiology 1969; 17: 214-218.
- Bisht R, Katiyar A, Singh R and Mittal P: Antibiotic resistance –a global issue of concern. Asian Journal of Pharmaceutical and Clinical Research 2009; 2(2): 34-39.
- Muriuki SW, Neondo JO and Budambula NLM: Detection and Profiling of Antibiotic Resistance among Culturable Bacterial Isolates in Vended Food and Soil Samples. International Journal of Microbiology 2020; 1–12.
- Sambrook J and Russell DW: Molecular Cloning: A Laboratory Manual. Edition 3rd Cold Spring Harbor Laboratory Press, New York, NY, USA 2001; 2.
- Van TT, Chin J, Chapman T, Tran LT and Coloe PJ: Safety of raw meat and shellfish in vietnam: an analysis of escherichia coli isolations for antibiotic resistance and virulence genes. International Journal of Food Microbiology 2008; 124(3): 217-223.
- Rahman MM, Husna A, Elshabrawy HA, Alam J, Runa NY, Badruzzaman ATM, Banu NA, Mamun MA, Paul B, Das S, Rahman MM, Mahbub‑E‑Elahi ATM, Khairalla AS and Ashour HM: Isolation and Molecular Characterization of Multidrug-Resistant Escherichia coli from Chicken Meat. Scientific Reports 2020; 10(1). doi:10.1038/s41598-020-78367-2.
- Randall LP, Cooles SW, Osborn MK, Piddock LJ and Woodward MJ: Antibiotic Resistance Genes, Integrons and Multiple Antibiotic Resistance in Thirty-Five Serotypes of Salmonella enterica Isolated from Humans and Animals in the UK. Journal of Antimicrobial Chemotherapy 2004; 53(2): 208-216.
- Cappuccino JG and Sherman N: Microbiology- A Laboratory Manual. Edition 7th Pearson Education Inc 2004.
- Nahar A, Islam MA, SoburMA, Hossain MJ, Zaman SB, Rahman MB, Lutful Kabir SM and Rahman MT: Detection of Tetracycline Resistant E. coli and Salmonella spp. in Sewage, River, Pond and Swimming Pool in Mymensingh, Bangladesh. African Journal of Microbiology Research 2019; 13(25): 382-387.
- Nwidu LL, Oveh B, Okoriye T and Vaikosen NA: Assessment of the Water Quality and Prevalence of Water Borne Diseases in Amassoma, Niger Delta, Nigeria. African Journal of Biotechnology 2008; 7(17): 2993-2997.
- Akubuenyi FC, Uttah EC and Enyi-Idoh KH: Microbiological and Physicochemical Assessment of Major Sources of Water for Domestic uses in Calabar Metropolis, Cross River State, Nigeria. Transnational Journal of Science and Technology2013; 3(2): 31-44.
- Adamu MO, Ishaleku D, Ngwai YB, Obiekezie SO and Owuna JE: Antibiotic Susceptibility Profile and Molecular Detection of tetA Genes in Tetracycline Resistant Salmonella Species Isolated from Different Water Sources in Keffi, Nasarawa State, Nigeria. South Asian Journal of Research in Microbiology 2020; 6(4): 27-41.
- Adzitey F, Ashiagbor CKN and Abu H: Prevalence and Antibiotic Susceptibility of Salmonella spp. from Water Sources in Tamale, Ghana. International Journal of One Health 2016; 2: 24-28.
- Wegener HC: Antibiotic Resistance Linking Human and Animal Health. In: Improving Food Safety Through a One Health Approach: Workshop Summary. Washington, DC: National Academies Press 2012; 331-349.
- Makut MD, Nyam MA, Amapu TY and Ahmed A: Antibiogram of Bacteria Isolated from Locally Processed Cow Milk Products Sold in Keffi Metropolis, Nasarawa State, Nigeria. Journal of Biology, Agriculture and Healthcare 2014; 4(4): 19-25.
How to cite this article:
Singh P, Rathore N, Tenguria P, Katariya R and Tenguria M: Molecular screening for prevalence of antibiotic resistant Salmonella spp. in drinking water samples from slum areas of Bhopal City, India. Int J Pharm Sci & Res 2022; 13(7): 2730-37. doi: 10.13040/IJPSR.0975-8232.13(7).2730-37.
All © 2022 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
19
2730-2737
601 KB
1002
English
IJPSR
Priyanka Singh, Nitish Rathore, Priyavanda Tenguria, Rajnandani Katariya and Mayank Tenguria *
Biopharmaceutical & Biomedical Division, Lenience Biotech Lab, Bhopal, Madhya Pradesh, India.
leniencebiotech@gmail.com
15 November 2021
25 January 2022
05 May 2022
10.13040/IJPSR.0975-8232.13(7).2730-37
01 July 2022





