NOOTROPIC ACTIVITY OF ISORHAMNETIN IN AMYLOID BETA 25-35 INDUCED COGNITIVE DYSFUNCTION AND ITS RELATED mRNA EXPRESSIONS IN ALZHEIMER’S DISEASE
HTML Full TextNOOTROPIC ACTIVITY OF ISORHAMNETIN IN AMYLOID BETA 25-35 INDUCED COGNITIVE DYSFUNCTION AND ITS RELATED mRNA EXPRESSIONS IN ALZHEIMER’S DISEASE
Deivasigamani Asha and Thangarajan Sumathi*
Department of Medical Biochemistry, Dr. ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Taramani Campus, Chennai - 600113, Tamil Nadu, India
ABSTRACT: Oxidative stress appears to be an early event involved in the pathogenesis of Alzheimer’s disease. The present study was designed to investigate the neuroprotective effects of isorhamnetin (IRN) against amyloid beta 25-35 (Aβ 25-35)-induced memory impairment and oxidative damage in rats. Memory task was assessed using Y-arm maze and it revealed the impairment in spatial memory. The IRN treated rats showed improvement in memory task. Aβ 25-35 induced animals also exhibited increase in hydrogen peroxide (H2O2), Monoamine oxidase activity (MAO) and decrease in choline acetyltransferase (ChAT) activity. It also enhanced the expression of inducible nitric oxide synthase (iNOS) and proinflammatory cytokine, IL-β whereas all these abnormalities were reduced significantly in IRN treated rats showing the neuroprotective effect of IRN against Aβ 25-35 induced Alzheimer’s disease (AD). Thus, IRN may be a potential therapeutic agent for Alzheimer’s disease
| Keywords: |
Y-arm, proinflammatory
cytokine, iNOS, ChAT
INTRODUCTION: The deposition of Aβ in the brain is assumed to initiate a pathological cascade that results in synaptic dysfunction, synaptic loss, neuronal death, and cognitive dysfunction 1. Amyloid beta (Aβ) is thought to be a major pathological cause of Alzheimer’s disease. The Aβ (25–35) is a partial fragment of Aβ that similarly forms a β-sheet structure 2 and induces neuronal cell death 2-3, neurite atrophy 4-5, synaptic loss 4-6 and memory impairment 5, 6, 8. There are many reports showing that mice injected with Aβ (25–35) suffer from memory impairment and neurite and synaptic atrophy 5, 6, 8, 9.
It has been confirmed that peroxynitrite-mediated damage contributes to Aβ-induced neuronal toxicity and cognitive deficits 10, 11 and is widespread in the brain of AD patients 12. In AD patients, learning and memory are impaired by the concomitant loss of the cholinergic marker enzyme, choline acetyltransferase (ChAT), in the cerebralcortex13.
Flavonoids exert a multiplicity of neuroprotective actions within the brain, including a potential to protect neurons against injury induced by neurotoxins, an ability to suppress neuroinflammation, and the potential to promote memory, learning and cognitive function. Isorhamnetin is an abundant Flavonolaglycone in herbal medicinal plants, such as sea buckthorn (Hippophaerhamnoides L.) and Ginkgo biloba L., which are frequently used inthe prevention and treatment of cardiovascular diseases 14-15. A number of studies suggested that isorhamnetin can protect endothelial cells from injury caused by oxidized low-densitylipoprotein16, decrease blood pressure 17, and alleviate the damages of ischemia-reperfusion (I/R) to ventricular myocytes 18.
In the present study, to confirm the protective activity of isorhamnetin against Aβ-induced neurotoxicity, we investigated whether IRN prevents memory impairment in an Aβ25–35-injected animal model of AD. Biochemical analysis of neurotransmitter enzyme was carried out to check the improvement in cognitive function. In addition, expressions of iNOS and IL-β mRNA in the hippocampus of Aβ25–35-injected rats were analyzed using reverse transcriptase PCR.
MATERIALS AND METHODS:
Chemicals:
Aβ25–35 and Isorhamnetin were purchased from Sigma-Aldrich. Acetyl coenzyme A, ethylene diamine tetra acetic acid (EDTA) and dithiothreitol (DTT) were purchased from Sisco Research Laboratories (SRL). Other chemicals were analytical grade.
Animals and Grouping:
Male albino rats weighing between 250–300g bred in Central Animal House, Dr. ALMPGIBMS, University of Madras, Taramani campus, Chennai 113, Tamil Nadu, India were used. The animals were housed under standard laboratory conditions and maintained on natural light and dark cycle, and had free access to food and water. Animals were acclimatized to laboratory conditions before the experiment. The experimental protocols were approved by the Institutional Animal Ethics Committee (IAEC) (IAEC NO. 01/05/2014) Dr. ALMPGIBMS, University of Madras, Taramani campus, Chennai 113, Tamil Nadu, India.
The rats were divided into six groups and six animals of each group. Group I: sham-operated control received 5µl of vehicle (PBS/DMSO) through intracerebroventricular injection. Group II: Rats were given Aβ 25-35 (10µg/rat) through intracerebroventricular injection on 1st day. Group III: Rats were given Aβ 25-35 (10µg/rat) through intracerebroventricular injection on 1st day (after one hour) followed by intraperitoneal administration of isorhamnetin (25 mg/kg in PBS/DMSO) for 21days.Group IV: Rats were given Aβ 25-35 (10µg/rat) through intracerebroventricular injection on 1st day (after one hour) followed by intraperitoneal administration of isorhamnetin (50 mg/kg in PBS/DMSO) for 21 days. Group V: Rats were given isorhamnetin (25mg/kg in PBS/DMSO) intraperitoneally for 21 days. Group VI: Rats were given isorhamnetin (50mg/kg in PBS/DMSO) intraperitoneally for 21 days.
Preparation of aggregated amyloid beta 25-35 and Intracerebroventricular injection:
Aβ25–35 was “aged” by incubation at 37°C for 4 days as described previously 6. Rats were anesthetized by intraperitoneal (i.p.) injections of ketamine and xylazine and placed in a stereotaxic holder (Instruments and Chemicals, Ambala, New Delhi). A midline sagittal incision was made in the scalp and hole was drilled in the skull over the intracerebroventricle using the following coordinates: 0.8 mm posterior to Bregma, 1.5 mm lateral to the midline and 3.8 mm beneath the dura. All injections were made using a 10-μl Hamilton syringe equipped with a 26-gauge needle. The dura was perforated with the needle of the microsyringe. Animals were infused with 5μl of sterile distilled water (vehicle-treated), aggregated Aβ25–35 (2μg/μl) into cerebral lateral ventricle at a rate of 1μl/min; the needle was left in place for an additional 5 min to permit sufficient diffusion and to avoid pressure induced damage. The scalp was then closed with a suture.
Postoperative Care:
Recovery of anesthesia took approximately 4–5 h. The rats were kept in a well-ventilated room at 25 ± 3ºC in individual cages until they gained full consciousness. Food and water were kept inside the cages for the first week, allowing animals’ easy access, without physical trauma due to overhead injury. Animals were then treated normally; food, water, and the bedding of the cages were changed often.
Y-maze task:
Y-maze task is used to measure the spatial working through the spontaneous alternation of behaviour 19. The maze is made of black painted wood. Each arm is 40 cm long, 13 cm high, 3 cm wide at the bottom, 10 cm wide at the top, and converges at an equal angle. Each mouse is placed at the end of one arm and allowed to move freely through the maze during an 8-min session. Rats tend to explore the maze systematically, entering each arm in turn. The ability to alternate requires that the rat know which arm they have already visited. The series of arm entries, including possible returns into the same arm, are recorded visually. Alternation is defined as the number of successive entries into the three arms, on overlapping triplet sets. The percentage of alternation is calculated as the ratio of actual alternations, defined as the total number of arm entries minus two, and multiplied by100.
Dissection and Homogenization:
On day 22, animals were sacrificed for biochemical estimations. The animals were sacrificed and the brain was removed by decapitation. Hippocampus was separated from each isolated brain. A 10% (W/V) tissue homogenate were prepared in 0.1 M phosphate buffer (pH 7.4). The aliquots of supernatant were separated and used for biochemical estimations.
Biochemical Analysis:
Estimation of protein: The total protein content was measured according to the method of Lowry et al. (1951) 20 using bovine serum albumin as standard.
Hydrogen Peroxide Assay:
The hydrogen peroxide (H2O2) generation was assayed by the method of Pick and Keisari 21. Horseradish peroxidase converts hydrogen peroxide in to water and oxygen. This causes oxidation of phenol redforms adduct with dextrose which hasmaximum absorbance at 610nm and can be recorded spectrophotometrically. Levels of H2O2 generation were expressed as nM of H2O2-generated/mg protein.
ChAT activity:
The choline acetyltransferase (ChAT) activity was determined spectrophotometrically according to Wolfgram(1972) 22. The reaction mixture contained sodium phosphate buffer (pH 7.0), acetyl coenzyme A, chloride choline, physostigmine, NaCl, EDTA, hydrochloric creatinine and DTT. The mixture was preincubated at 37 °C for 5 min then mixed with the hippocampus homogenates, incubated at 37 °C for20 min and finally stopped the reaction in boiling water. Sodium arsenate was added to each tube for precipitation. The supernatant was mixed with 3 nM 4-PDS and incubated at 25 °C for 15 min. Absorbances were read at 324 nm.
Monoamine oxidase:
Monoamine oxidase (MAO) levels were measured by the method of Tabor et al.23 this method is based on measurement of benzaldehyde formed with benzyl-amine hydrochloride (0.1 M) used as substrate. The absorbance was read at 340 nm and expressed as nmolbenzaldehyde/min/mg protein.
Total RNA isolation and mRNA expression of iNos and IL-β by RT-PCR:
Total RNA was purified from freshly isolated brain tissue using 1 mL of the TRI reagent by the method of Chomczynski and Sacchi (1987) 24. The RNA purity and concentration were determined using using Nano drop (Thermo Scientific) at A260/A280 nm. The purity of RNA obtained was 1.8–2.0. One microliter of total RNA was reverse transcribed by RT-PCR kit (Thermo scientific) according to the manufacturer’s instructions and further amplified by PCR. The details of the primer used, and size of the PCR amplified products are listed in Table 1. The PCR products were resolved by electrophoresis through 1.5% agarose gel and stained with ethidium bromide. The densities of PCR products in the agarose gel were scanned with a Gel Doc image scanner (Bio-Rad, USA) and quantified by Quantity One Software (Bio-Rad, USA).
TABLE 1: THE DETAILS OF PRIMERS USED
| Target gene | Primer sequences | Annealing temperature | Product Size (bp) | |
| IL-6
iNOS |
F: 5′ TCAAGGCATAACAGGCTCATC 3′
R:5′ TCTGTCAGCCTCAAAGAACAGG 3′
F: 5’TCCTCTTTGCTACTGAGACAAGG3′ R:5′ TACTGGTCCATGCAGACAACC3 |
56
56 |
150
103 |
|
Statistical analysis:
The data was analyzed by using analysis of variance (ANOVA) followed by Tukey’s test. All the values are expressed as mean±S.D. In all tests, the criterion for statistical significance was P< 0.05.
Effect of isorhamnetin on Aβ25–35 induced impairment in spatial memory in Y- arm maze task:
Aβ25–35 injected group showed significant decrease (P<0.01) in the percentage alternation in Y-arm task as compared to control group on 14th and 21st day (Fig.1), thereby showing significant impairment in spatial cognition of Aβ25–35 induced rats. Significant improvement in spatial cognition (P<0.01) was noted inisorhamnetin (25mg/ kg b.wt.) treated groups than the IRN 50mg/kg b.wt. treated rats (P<0.05). No significant change was found in the isorhamnetin (25mg/kg and 50 mg/kg, b.wt) per se group when compared to the control group.
FIG. 1: EFFECT OF ISORHAMNETIN ON SPATIAL COGNITION IN Y- ARM MAZE TASK IN Aβ25–35 INDUCED RATS
a P< 0.01 versus vehicle-treated group, bP< 0.01 and c P < 0.05 versus Aβ25–35 induced group, (one-way ANOVA followed by Tukey’s test). Data presented are mean ± SD (n=6). The values are expressed as number of correct choices.
Effect of isorhamnetin on Aβ25–35 induced changes in level of H2O2 in hippocampus of control and experimental rats:
There was significant (P< 0.01) increase in the H2O2 level in hippocampus of Aβ25–35 injected group as compared to control group (Fig.2). Isorhamnetin (25mg/ kg b.wt.) was able to counteract and reduced H2O2 level significantly (P<0.01) as compared to the Aβ25–35 injected group whereas the rats treated with IRN 50mg/kg, b.wt. (P<0.05) showed less effect than the Isorhamnetin 25mg/ kg b.wt. treated rats. The group treated with isorhamnetin (25 and 50 mg/kg, b.wt) alone did not show significant effect on level of H2O2 as compared to the control group.

FIG. 2: EFFECT OF ISORHAMNETIN ON Aβ25–35 INDUCED CHANGES IN LEVEL OF H2O2 IN HIPPOCAMPUS OF CONTROL AND EXPERIMENTAL RATS.
Data presented are mean± SD (n = 6).The units expressed as nmoles of H2O2 consumed/mim/mg protein. aP<0.01 as compared to the vehicle-treated group; bP<0.01 and cP<0.05 as compared to Aβ25–35 induced group (one-way ANOVA followed by Tukey’s test).
Ameliorative effect of isorhamnetin on Aβ25–35 induced changes in activity of ChAT in hippocampus of control and experimental rats:
ChAT activity was found lowered significantly in Aβ25–35 induced group (P<0.01) as compared to control animals (Fig.3). Treatment with isorhamnetin (25mg/ kg b.wt.) significantly (P<0.01) increased the ChAT activity than the group treated with isorhamnetin (50mg/kg b.wt.) (P<0.05) as compared to the Aβ25–35 induced group .There was no significant change found on the activity of ChAT in isorhamnetin (25 and 50 mg/kg, b.wt) alone treated group while compared to the control group.

FIG. 3: EFFECT OF ISORHAMNETIN ON THE ACTIVITY OF CHAT IN HIPPOCAMPUS OF Aβ25–35 INDUCED RATS
Data presented are mean± SD (n = 6).The units expressed as nmoles/g protein. aP<0.01 as compared to the vehicle-treated group; bP<0.01 and cP<0.05 as compared to Aβ25–35 induced group (one-way ANOVA followed by Tukey’s test).
Attenuating effect of isorhamnetin on Aβ25–35 induced changes in the activity of MAO in hippocampus of control and experimental rats:
Aβ25–35 injected group showed siginificant (P<0.01) increase in the activity of MAO in hippocampus compared to control group (Fig.4). Treatment with isorhamnetin (25mg/ kg b.wt.) significantly (P<0.01) attenuated the abnormal increase in MAO activity and reverted it to normal when compared with Aβ25–35 induced group whereas the group treated with isorhamnetin (50mg/kg b.wt.) showed less significant (P<0.05) effect compared to the isorhamnetin 25mg/ kg b.wt. treated rats. Treatment with isorhamnetin (25mg/kg b.wt. and 50mg/kg b.wt.) alone did not show significant change on activity of MAO when compared with the control group.

FIG. 4: EFFECT OF ISORHAMNETIN ON THE ALTERATIONS IN THE MAO LEVELS IN HIPPOCAMPUS OF CONTROL AND EXPERIMENTAL RATS.
aP<0.01 as compared to the vehicle-treated group; bP<0.01 and cP<0.05 as compared to Aβ25–35 induced group, (one-way ANOVA followed by Tukey’s test). Data presented are mean ± SD (n=6).MAO-Monoamine Oxidase. MAO units expressed as nmoles/mg protein.
Ameliorative effect of isorhamnetin on Aβ25–35 induced changes in mRNA expression of iNOS in hippocampusof control and experimental rats: There was an abnormal (p<0.01) increase in iNOS mRNA expression in hippocampus of Aβ25–35 induced group as compared to control animals whereas isorhamnetin(25mg/kg b.wt.) treated group showed the significant decrease (p<0.05) in abnormal expression of iNOS (Fig.5). The group treated with isorhamnetin (25mg/kg b.wt.) alone showed normal expressions of iNOS when compared with the control group.

FIG.5: THE EFFECT OF ISORHAMNETIN ON Aβ25–35 INDUCED mRNA EXPRESSION OF iNOS IN CONTROL AND EXPERIMENTAL RATS
Lane M: DNA marker Lane.1. control group showing normal expression of iNOS. Lane.2. Increased expression of iNOS in Aβ25–35 induced group. Lane.3 Aβ25–35 + IRN 25mg/kg b.wt. treated group showing normal expression of iNOS (Lane .3). Lane.4. IRN alone treated group showing normal expression of iNOS. Data represents mean±SD of six rats in each group. Levels of mRNA were normalized to that of β actin. Statistical significance (P value): ap<0.01 significantly different from control group. bp<0.05 different from Aβ25–35 induced group.
Effect of isorhamnetin on Aβ25–35 induced changes in mRNA expression of IL-β in hippocampus of control and experimental rats:
Aβ25–35 induced group showed an abnormal increase (p<0.01) in IL-β expression in hippocampus as compared to control animals (Fig.6). There was the significant decrease (p<0.05) in abnormal expression of IL-β in isorhamnetin (25mg/kg b.wt.) treated group. The group treated with isorhamnetin (25mg/kg b.wt.) alone showed normal expressions of IL-β when compared with the control group.

FIG.6: THE EFFECT OF ISORHAMNETIN ON Aβ25–35 INDUCED mRNA EXPRESSION OF IL-β IN CONTROL AND EXPERIMENTAL RATS
Lane M: DNA marker Lane.2. control group showing normal expression of IL-β. Lane.3. Increased expression of IL-β in Aβ25–35 induced group. Lane.3 Aβ25–35 + IRN 25mg/kg b.wt. treated group showing normal expression of IL-β(Lane.3). Lane.4. IRN alone treated group showing normal expression of IL-β. Data represents mean±SD of six rats in each group. Levels of mRNA were normalized to that of β actin. Statistical significance (P value): ap<0.01 significantly different from control group. bp<0.05 different from Aβ25–35 induced group.
DISCUSSION: Aβ (25–35) is potential neurotoxic peptide for primary neuronal cortical cells which produces neurofibrillary tangles25-26 and the toxicity induced by Aβ (25–35) in rodents resembles to AD which is suitable for the evaluation of Alzheimer’s type of dementia. Isorhamnetin, which is an O-methylated metabolite formed in the small intestine and liver, and increased in the human brain, has a higher BBB permeability than aglycone by its apparent lipophilicity 27. The O-methylated metabolites of derived flavonoids have the potential to improve human memory and neuro-cognitive performance via their ability to protect vulnerable neurons and long-term potentiation, which is considered as major mechanism of memory in the brain.
In this study the Aβ (25–35) induce impairment in short term memory was significantly alleviated by the isorhamnetin treatment. It has been reported that Aβ induces the production of hydrogen peroxide and lipid peroxide in hippocampal neurons of the rat brain 28. There was an increase in the level of hydrogen peroxide indicating increase in oxidative stress and decrease in antioxidant activity in hippocampus. Isorhamnetin has been shown to alleviate the hydrogen peroxide induced oxidative stress in previous studies. In this study also IRN reduced the level of hydrogen peroxide via its antioxidant activity.
In AD patients, learning and memory are impaired by the concomitant loss of the cholinergic marker enzyme, choline acetyltransferase (ChAT), in the cerebral cortex 29. In this study, the Aβ (25–35) induced decrease in ChAT activity was reverted to normal by the IRN treatment and which may account for the improvement in the short term memory as assessed by y arm maze.
Aβ 25-35 has the potential to induced oxidative stress in the brain cholinergic hypo function, elevation of AChE and MAO 30-32. It is well accepted that oxidative stress (associated with MAO) contributes to the disturbance of neurotransmitters, including NE and the cholinergic system, which have a critical role in the cognitive impairment in AD 33-35. Elevations in MAOA in Alzheimer neurons have been linked to increase in neurotoxic metabolites and neuronal loss. Compelling studies have shown that the involvement of MAO in AD and neurodegenerative diseases plays an important role in several key pathophysiological mechanisms 36-37.
Elevated monoamine levels in the brain resulting from MAO induce changes in other neurotransmitter systems and lead to cognitive impairment. The isorhamnetin has been reported to inhibit MAO- A by 55% at 1.26 µM 38. Aβ 25-35 induced animals exhibited the increase in MAO activity whereas IRN reduced the abnormal increase in activity of MAO .It might be the reason for improving the spatial memory in Y-arm maze.
In this study, we found that IRN significantly inhibited the increase of iNOS mRNA in the hippocampus induced by Aβ25–35. It has been demonstrated in vitro that the stimulation of neuronal cell lines with TNF-α leads to increased expression of inducible nitricoxide synthase and subsequent apoptosis 39. We analyzed the expression of TNF-α in hippocampus of control and experimental rats. There was marked elevation in TNF-α expression which was reduced by IRN treatment (data not given). Hence, decrease in TNF-α would be the reason for reduction in the iNOS expression. In contrast to the NO synthesized by nNOS, which facilitates learning and memory formation under physiological conditions 40-43, the NO synthesized by iNOS is deleterious 44. The iNOS produced a large amount of NO, which may cause neurotoxicity in vitro, has been previously reported 45, 46. It has been reported that isorhamnetin treatment down regulated the expression of iNOS, a key enzyme for catalyzing NO production47-48. IRN alleviated the oxidative stress in hippocampus by reducing the peroxinitrite formation via inhibiting iNOS expression.
TNF-α and IL-1β are involved in the inflammatory response, and they may also be toxic to neurons and glial cells 49.The increased level of pro-inflammatory cytokines in the central nervous system was shown to impair cognitive function50 and play a fundamental role in the pathogenesis of AD 51-52 .In corroboration with previous report, there was an increase in the expression of IL-β in Aβ 25-35 induced rats 53. The current study reveals that Aβ 25-35 induced the expression of proinflammatrory cytokine, IL-β which was significantly reduced by IRN treatment. Pro-inflammatory cytokine upregulation and excessive NO production play important roles in severe inflammatory diseases 54. Inhibition of pro-inflammatory cytokines and NO release in inflammatory cells could therefore beneficially attenuate excessive inflammatory response. In conclusion the IRN was able to revert the abnormal expression of iNOS and IL-β to normal, thereby improved the cognitive function and reduced the oxidative stress subsequently apoptosis.
CONCLUSION: In summary, this study highlights the potential neuroprotective mechanisms of IRN involved in improvement of cognitive function. Together, the results of the present study suggest that administration of isorhamnetin prevents Aβ 25-35 induced cognitive impairment and associated oxidative stress. Hence, neuroprotective activity of IRN may be mediated through free radical scavenging activity and inhibition of proinflammatorycytokine and iNOS.
ACKNOWLEDGEMENTS: The financial support extended by UGC in the form of project fellow under UGC- BSR Research fellowship in science is gratefully acknowledged.
CONFLICT OF INTEREST: The authors declare that there is no conflict of interests.
REFERENCES:
- Walsh DM and Selkoe DJ. Deciphering the molecular basis of memory failure in Alzheimer’s disease. 2004; 44:181–193.
- Pike CJ, Walencewicz-Wasserman AJ, Kosmoski J, Cribbs DH, Glabe CG, Cotman CW. Structure-activity analyses of b-amyloid peptides: contribution of the b25–35 region to aggregation and neurotoxicity. J Neurochem.1995; 64: 253–265.
- Yankner BA, Duffy LK, Kirschner DA. Neurotrophic and neurotoxic effects of amyloid b protein: reversal by tachykinin neuropeptides. Science. 1990; 250: 279–282.
- Grace EA, Rabiner CA, BusciglioJ.Characterization of neuronal dystrophy induced by fibrillar amyloid b: implications for Alzheimer’ disease. Neuroscience. 2002; 114: 265–273.
- Tohda C, Matsumoto N, Zou K, Meselhy MR, Komatsu K Ab(25–35)-induced memory impairment, axonal atrophy and synaptic loss are ameliorated by M1, a metabolite of protopanaxadiol- type saponins. Neuro psyco pharmacology. 2004; 29: 860–868.
- Tohda C, Tamura T, Komatsu K. Repair of amyloid b(25–35)- induced memory impairment and synaptic loss by a Kampo formula, Zokumei-to. Brain Res 2003; 990: 141–147.
- Maurice T, Lockhart BP, Privat A. Amnesia induced in mice by centrally administered b-amyloid peptides involves cholinergic dysfunction. Brain Res. 1996; 706: 181–193.
- Kuboyama T, Tohda C, Komatsu K .Neuritic regeneration and synaptic reconstruction induced by withanolide A. Br J Pharmacol2005;144: 961–971.
- Kuboyama T, Tohda C, Komatsu K. Withanoside IV and its active metabolite, sominone, attenuate Ab(25–35)-induced neurodegeneration. Eur J Neurosci.2006; 23: 1417–1427.
- Tran MH, Yamada K, Nakajima A, Mizuno M, He J, Kamei H, and Nabeshima T Tyrosine nitration of a synaptic protein synaptophysin contributes to amyloid beta-peptide-induced cholinergic dysfunction. Mol Psychiatry.2003;8:407–412
- Alkam T, Nitta A, Mizoguchi H, Saito K, Seshima M, Itoh A, Yamada K, and NabeshimaT Restraining tumor necrosis factor-_ by thalidomide prevents the amyloid _-induced impairment of recognition memory in mice. Behav Brain Res .2008; 189:100–106.
- Smith MA, Richey Harris PL, Sayre LM, Beckman JS, and Perry G Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J Neurosci.1997;17: 2653–2657
- Wilcock, G.K., Esiri, MN. Bowen, D.M. & Smith, C.C. Alzheimer's disease: Correlation of cortical choline acetyltransferase activity with the severity of dementia and histological abnormalities. J. Neurol. Sci. 1982; 57, 407-417.
- Zhao G, DuanJ, Xie Y, Lin G, Luo H, et al. Effects of solid dispersion and self-emulsifying formulations on the solubility, dissolution, permeability and pharmacokinetics of isorhamnetin, quercetin and kaempferol in total flavones of Hippophaerhamnoides L. Drug DevInd Pharm 2012;3: 3.
- Bao M, Lou Y Isorhamnetin prevents endothelial cell injuries from oxidized LDL via activation of p38MAPK. Eur J Pharmacol.2009; 547: 22–30.
- Ibarra M, Moreno L, Vera R, Cogolludo A, Duarte J, et al. Effects of the flavonoid quercetin and its methylated metabolite isorhamnetin in isolated arteries from spontaneously hypertensive rats. Planta Med2003; 69: 995–1000.
- Zhang N, Pei F, Wei H, Zhang T, Yang C, et al. Isorhamnetin protects rat ventricular myocytes from ischemia and reperfusion injury. Exp Toxicol Pathol2011; 63: 33–38.
- Sun B, Sun GB, Xiao J, Chen RC, Wang X, et al. Isorhamnetin inhibits H(2)O(2)-induced activation of the intrinsic apoptotic pathway in H9c2 cardiomyocytes through scavenging reactive oxygen species and ERK inactivation. J Cell Biochem.2012; 113: 473–485.
- Tangui Maurice, Brain P Lockhart, Alain Privat, Amnesia induced in mice by centrally administered β-amyloid peptide involves cholinergic dysfunction, Brain Research 1996; 706: 181-193.
- Lowry OH, Rosebrough NJ, Farr AL, Ranell RJ. Protein measurements with the Follin’s phenol reagent. J BiolChem 1951; 193: 265–275.
- Pick, E., Keisari, Y. Superoxide anion and H2O2 production by chemically elicited peritoneal macrophages-induction by multiple nonphagocytic stimuli. Cell. Immunol. 1981; 59, 301–318.
- Wolfgram, F. Spectrophotometric assay for choline acetyltransferase. Anal. Biochem. 1972; 46, 114–118.
- Tabor H, Mehler AH, Stadtman ER. The enzymatic acetylation of amines.J Biol Chem. 1953;204:127–38
- Chomczynski P and Sacchi N. "Single - step method of RNA isolation by acid guanidiniumthiocyanate phenol chloroform extraction". Anal. Biochem. 1987; 162: 156-159.
- Glenner, G.G., Wong, C.W., 1984. Alzheimer’s disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochemical and Biophysical Research Communications 120, 885–890.
- Masters, C.L., Gail, S., Nicola, A.W., Gerd, M., Brian, L., Mcdonald,Konrad, B. Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proceedings of the Indian National Science Academy 1985;82: 4245–4249.
- Spencer, J.P.E. Food for thought: The role of dietary flavonoids in enhancing human memory, learning and neuro-cognitive performance. Proceedings of the Nutrition Society.2008; 67(2): 238–252.
- Yatin SM, Varadarajan S, Butterfield DA, Vitamin E prevents Alzheimer’s amyloid beta-peptide (1-42) induced neuronal protein oxidation and reactive oxygen species production. Journal of Alzheimer’s disease 2000; 2: 23–131.
- Noshita T,Murayama N, Nakamura S. Effect of nicotine on neuronal dysfunction induced by intracerebro ventricular infusion of amyloid-β peptide in rats. Eur Rev Med Pharmacol Sci. 2015; 19(2):334-43.
- Casanova MF, Walker LC, Whitehouse PJ, Price DL, Abnormalities of the nucleus basalis in Down’s syndrome. Neurol 1985; 18: 310– 313.
- Alvarez A Opazo C, Alarcon R Garrido J, Inestrosa NC, Acetylcholinesterase promotes by forming a complex with growing fibrils. Mol.Biol 1997; 272: 348-/361.
- Takehashi M, Tanaka S, Masliah E, Ueda K, Association of monoamine oxidase Agene polymorphism with Alzheimer’s disease and Lewy body variant. NeurosciLett 2002; 327: 79–82.
- Engelborghs S and De Deyn PP: The neurochemistry of Alzheimer’s disease. ActaNeurol Belg.1997; 97:67–84.
- Ishrat T, Parveen K, Khan MM, Khuwaja G, Khan MB, Yousuf S, Ahmad A, Shrivastav P and Islam F: Selenium prevents cognitive decline and oxidative damage in rat model of streptozotocin-induced experimental dementia of Alzheimer’s type. Brain Res. 2009; 1281:117–127.PubMed/NCBI
- Schaeffer EL and Gattaz WF: Cholinergic and glutamatergic alterations beginning at the early stages of Alzheimer disease: participation of the phospholipase A2 enzyme. Psychopharmacology (Berl). 2008; 198:1–27. View Article: Google Scholar
- Huang L, Lu C, Sun Y, Mao F, Luo Z, Su T, Jiang H, Shan W and Li X: Multitarget-directed benzylideneindanone derivatives: anti-β-amyloid (Aβ) aggregation, antioxidant, metal chelation, and monoamine oxidase B (MAO-B) inhibition properties against Alzheimer’s disease. J Med Chem.2012; 55:8483–8492.PubMed/NCBI
- Zheng H, Fridkin M and Youdim MB: From antioxidant chelators to site-activated multi-target chelators targeting hypoxia inducing factor, beta-amyloid, acetylcholinesterase and monoamine oxidase A/B. Mini Rev Med Chem.2012; 12:364–370.View Article : Google Scholar
- Sloley BD, Urichuk LJ, Morley P, Durkin J, Shan JJ, Pang PK, Coutts RT Identification of kaempferol as a monoamine oxidase inhibitor and potential neuroprotectant in extracts of Ginkgo biloba leaves. J Pharm Pharmacol.2000;52:451–459
- Heneka MT, Lo¨schmann PA, Gleichmann M, Weller M, Schulz JB, Wu¨ llner U, and Klockgether T Induction of nitric oxide synthase and nitric oxide-mediated apoptosis in neuronal PC12 cells after stimulation with tumor necrosis factoralpha/ lipopolysaccharide. J Neurochem.1998; 71:88–94.
- Böhme, G.A., Bon, C., Lemaire, M., Reibaud, M., Piot, O., Stutzmann, J.J.M., Doble, A.,and Blanchard, J.C. Altered synaptic plasticity and memory production in nitric oxidesynthase inhibitor-treated rats. Natl. Acad. Sci. USA 1993;90: 9191-9194
- Yamada, K., Noda, Y., Nakayama, S., Komori, Y., Sugihara, H., Hasegawa, T., and Nabeshima, T. Role of nitric oxide in learning and memory and in monoamine metabolism in the rat brain. J. Pharmacol. 1995; 115: 852-858
- Yamada, K., Hiramatsu, M., Noda, Y., Mamiya, T., Murai, M., Kameyama, T., Komori, Y.,Nikai, T., Sugihara, H., and Nabeshima, T. Role of nitric oxide and cyclic GMP in thedizocilpine-induced impairment of spontaneous alteration behavior in mice. 1996;74: 365-374
- Kendrick, K.M., Guevara-Guzman, R., Zorrilla, J., Hinton, M.R., Broad, K.D., Mimmack,M., and Ohkura, S. Formation of olfactory memories mediated by nitric oxide. Nature1997;388: 670-674
- Rahimian R1,Fakhfouri G, EjtemaeiMehr S, Ghia JE, Genazzani AA, Payandemehr B, Dehpour AR, Mousavizadeh K, Lim D. Tropisetron attenuates amyloid-beta-induced inflammatory and apoptotic responses in rats. Eur J Clin Invest. 2013; 43(10):1039-51. doi: 10.1111/eci.12141. Epub 2013 Aug 13.
- Dawson, T.M., Dawson, V.L., and Snyder, S.H. Molecular mechanisms of nitricoxide actions in the brain. N. Y. Acad. Sci. 1994:738: 76-85
- Hewett, S.J., Csernansky, C.A., and Choi, D.W. Selective potentiation ofNMDA-induced neuronal injury following induction of astrocyticiNOS. Neuron 1994;13,487-494
- Vasquez-Vivar J, Whitsett J, Ionova I et al Cytokines and lipopolysaccharides induce inducible nitric oxide synthase but not enzyme activity in adult rat cardiomyocytes. Free RadicBiol Med. 2008;45:994–1001
- Stadler K, Bonini MG, Dallas S et al Involvement of inducible nitric oxide synthase in hydroxyl radical-mediated lipid peroxidation in streptozotocin-induced diabetes. Free RadicBiol Med.2008; 45:866–874
- Smith JA, Das A, Ray SK, et al. Role of pro-inflammatory cytokines released from microglia in neurodegenerative diseases. Brain Res Bull. 2012; 87(1):10-20.
- Viel JJ, McManus DQ, Smith SS, et al. Age- and concen-tration-dependent neuroprotection and toxicity by TNF in cortical neurons from beta-amyloid. J Neurosci Res. 2001; 64(5):454-465.
- Rubio-Perez JM, Morillas-Ruiz JM. A review: inflammatory process in Alzheimer’s disease, role of cytokines. Scien-tific World Journal. 2012;2012:756357
- Shaftel SS, Griffin WS, O’Banion MK. The role of inter-leukin-1 in neuroinflammation and Alzheimer disease: an evolving perspective. J Neuroinflammation. 2008; 5:7.
- Zhang, L.L., Sui, H.J., Liang, B., Wang, H.M., Qu, W.H., Yu, S.X., Jin, Y. Atorvastatin prevents amyloid-β peptide oligomer-induced synaptotoxicity and memory dysfunction in rats through a p38 MAPK-dependent pathway. ActaPharmacol Sin 2014; 35: 716-726.
- Southan, G.J., Szabo, C. Selective pharmacological inhibition of distinct nitric oxide synthase isoforms. Biochem. Pharmacol. 1996; 51: 383–394
How to cite this article:
Asha D and Sumathi T: Nootropic activity of Isorhamnetin in Amyloid Beta 25-35 Induced Cognitive Dysfunction and Its Related mRNA Expressions in Alzheimer’s Disease. Int J Pharm Sci Res 2016; 7(8): 3233-42.doi: 10.13040/IJPSR.0975-8232.7(8).3233-42.
All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
8
3233-42
643
2116
English
IJPSR
Deivasigamani Asha and Thangarajan Sumathi*
Department of Medical Biochemistry, University of Madras, Chennai, Tamil Nadu, India
drsumathi.bioscience@gmail.com
30 March, 2016
12 July, 2016
14 July, 2016
10.13040/IJPSR.0975-8232.7(8).3233-42
01 August 2016






