PHENOTYPIC AND MOLECULAR DETECTION OF CARBAPENEMASE NEW DELHI METALLO BETA LACTAMASE-1 (NDM-1) GENE AMONG PSEUDOMONAS AERUGINOSA FROM VARIOUS CLINICAL ISOLATES
HTML Full TextPHENOTYPIC AND MOLECULAR DETECTION OF CARBAPENEMASE NEW DELHI METALLO BETA LACTAMASE-1 (NDM-1) GENE AMONG PSEUDOMONAS AERUGINOSA FROM VARIOUS CLINICAL ISOLATES
Sheeba Ali Siddiqui * 1, C. M. Noorjahan 1 and N. Arunagirinathan 2
P.G. & Research Department of Zoology 1, Justice Basheer Ahmed Sayeed College For Women, Teynampet, University of Madras, Chennai - 600018, Tamil Nadu, India.
Department of Microbiology 2, Presidency College, University of Madras, Chennai - 600005, Tamil Nadu, India.
ABSTRACT: Pseudomonas aeruginosa is an opportunistic pathogen which acquires resistance to antibiotics such as carbapenems and cefepime. Information regarding (NDM-1) gene producing Pseudomonas aeruginosa is available, but data regarding their degree of infection and percentage in hospital settings are scarce. Hence, this study was carried out to determine the occurrence of blaNDM-1 gene among clinical isolates of multidrug-resistant Pseudomonas aeruginosa in a tertiary care hospital in Chennai, Tamil Nadu, India. A total of 126 isolates of P. aeruginosa isolated from various clinical samples were evaluated for carbapenem resistance and MBL production. In the present study it was found that majority of isolates (39.7%) were resistant to imipenem followed by ertapenem (35.9%) and doripenem (24.3%). A total of 31/78 (39.7%) isolates of P. aeruginosa were resistant to one or both carbapenems (imipenem and ertapenem) used in the screening test. Out of 78 isolates, 27 (34.6%) and 25 (32.1%) isolates were MHT positive and MBL producers by Modified Hodge Test (MHT) and MBL E-Strip test respectively and Out of 25 MBL positive isolates, 7 (28%) isolates were positive, and 18 (72%) were negative for NDM-1 gene production. In this study prevalence of plasmid encoding NDM-1 gene was noted in Multidrug-resistant Pseudomonas aeruginosa. Screening of Pseudomonas aeruginosa along with routine antimicrobial susceptibility testing, Phenotypic and molecular screening should also be carried out regularly to reflect the proper number of metallo-beta-lactamase producers.
| Keywords: |
NDM-1 Gene, Combined disc test, E-test, Metallo beta lactamases, Modified Hodge test, Pseudomonas aeruginosa
INTRODUCTION: Pseudomonas aeruginosa is a leading cause of hospital-acquired infections in patients. Carbapenems, especially imipenem, are used for the treatment of these infections.
The prevalence of imipenem resistance P. aeruginosa has been increasing worldwide. Resistance to carbapenems is due to impermeability via the loss of the OprD porin, the up-regulation of an active efflux pump system of the cytoplasmic membrane, or the production of metallo-β-lactamases (MBLs).
These mechanisms can lead to treatment failure in carbapenem therapy of P. aeruginosa infections 1. Resistance to antibiotics has increased over the years among Pseudomonas aeruginosa as nearly most of the strains are now resistant to all commonly used antibiotics. These bacteria produce Metallo-β-lactamases (MBLs). Multidrug resistance among these organisms makes the treatment of infections caused by the very expensive and difficult to treat 2. Metallo-β-lactamases (MBLs) are metalloenzymes of Ambler class B and are clavulanic acid-resistant enzymes. They require divalent cations of zinc as co-factors for enzymatic activity and are universally inhibited by ethylenediamine tetra-acetic acid (EDTA), as well as other chelating agents of divalent cations 3. Metallo-β-lactamases producing P. aeruginosa isolates were first reported in Japan in 1991 and since then have been detected in various countries 4. Carbapenem groups of antibiotics play an important role in managing gram negative nosocomial infections because of their broad-spectrum activity and stability against hydrolysis by most of the β-lactamases, including extended-spectrum β-lactamases (ESBLs) 5.
The most potent antibacterial agents used for the treatment of infections caused by multidrug-resistant gram-negative bacilli are carbapenems, including imipenem (IPM or IP) and meropenem 6. Carbapenems are now frequently used as a reversed drug in treating infections caused by multidrug-resistant gram-negative bacilli. The detection of carbapenemase is difficult. It can be detected by phenotypic as well as genotypic methods. Among phenotypic tests Modified Hodge Test (MHT) is a relatively easy and simple method to be performed in a laboratory 7.
Many multidrug-resistant bacteria produce New Delhi metallo β lactamase-1, a type of carbapenemase which inactivates all β-lactams except aztreonam 3. Bacterial plasmids encoding the blaNDM-1 gene also encodes for other genes responsible for causing resistance to all amino-glycosides, macrolides, and sulphamethoxazole, thus making these isolates multidrug-resistant or resistant in some cases to all antibiotics 8. NDM-1 gene producing organisms may spread the multiple drug resistance to non-resistant organism through horizontal gene transfer. The presence of such asymptomatic carriers bearing multidrug-resistant NDM-1 gene organisms in the hospital environment is an alarming situation 9. Hence this study was carried out for Phenotypic and molecular detection of carbapenemase New Delhi Metallo beta Lactamase-1 (NDM-1) gene among Pseudomonas aeruginosa from various clinical isolates and to evaluate different phenotypic methods to guide clinicians in prescribing a proper antibiotic and controlling nosocomial infections.
MATERIALS AND METHODS:
Clinical Isolates: The samples were collected from a tertiary care hospital in Chennai, and the study was carried out for a period of one year from November 2017 to October 2018. A total of 126 isolates of P. aeruginosa isolated from various clinical samples were evaluated for carbapenem resistance, MBL production, and molecular detection of the NDM-1 gene. The isolates were identified by standard laboratory techniques. Subculturing was done on a regular basis in order to maintain the fresh cultures for the experiment. P. aeruginosa ATCC 27853 was included as a quality control strain 10. The isolates were confirmed by Grams staining, biochemical tests, pigment production, and growth at 42 °C 10. Antibiotic susceptibility testing was done on Mueller–Hinton agar by Kirby–Bauer disc-diffusion method, and the results were interpreted as per the CLSI 11. Screening for MBL production was done by Kirby–Bauer disc diffusion method 12, Imipenem-EDTA Combined Disc Test (CDT), and Modified Hodge Test (MHT) 13, 14. Confirmation of MBL production was done by the E-test (Himedia Mumbai, India), and molecular detection of the NDM-1 gene was carried out by PCR 12, 15.
Screening of Isolates for MBL Production: The in-vitro antibiotic cultural sensitivity of P. aeruginosa for MBL production was done by the disc diffusion method 11. The following antibiotics were used in the screening test: imipenem (10 µg), doripenem (10 µg), and ertapenem (10 µg) (Himedia Mumbai, India). The size of the zone of inhibition was read after overnight incubation at 37 °C and interpreted according to recommended MBL screening criteria as specified in CLSI protocol, M100-S22 12.
Confirmatory Methods:
Imipenem-EDTA Combined Disc Test (CDT): MBL production was confirmed by IMP-EDTA combined disc test 13. Imipenem disc (10 µg) and Imipenem/EDTA disc (10 µg/750 µg) (Himedia Mumbai, India) were placed on the dried plate inoculated with the P. aeruginosa. The disc was placed 10 mm apart from edge to edge. After 24 h of incubation at 37 °C, the inhibition zones of IMP and IMP/EDTA discs were compared. For MBL producing organisms, discs with IMP/EDTA increased inhibition zones by 8 to 15 mm, while the increase of such zones for MBL negative isolates were 1 to 5 mm according to CLSI guidelines, 2013 12.
Modified Hodge Test: The Meropenem and Imipenem resistant strains were subjected to MHT for detection of Carbapenemases. An overnight culture suspension of E. coli ATCC 25922, which was adjusted to 1:10 dilution of the 0.5 McFarland standard, was inoculated on the surface of the Muller Hinton agar plate evenly. After the brief drying at room temperature, 10 µg Ertapenem disk was placed in the center of the plate. Imipenem resistant test strain from an overnight culture was streaked heavily from the edge of the disk to the edge of the plate. After 24 h the presence of a distorted or clover leaf-shaped inhibition zone was interpreted as MHT positive due to Carbapenemase production by the test strain 14.
MBL E – Test: MRP/MRP+EDTA E -test strips (Himedia Mumbai, India) consisted of Meropenem (MRP) (4-256 µg/ml) and MRP (1-64 µg/ml) plus a constant level of EDTA. An inoculum (0.5 Mc Farland standards) was prepared from 24 h old culture of the P. aeruginosa test strain, inoculated on Muller Hinton Agar plate with the help of sterile cotton swabs.
After brief drying, E test strips were applied on MHA plates and incubated for 18-24 h at 37 °C. The MIC endpoints were read where the inhibition ellipses intersected the strips. A ratio of MICs of the Meropenem (MRP) to MRP+EDTA of ≥ 8 was interpreted as MBL positive 12. S. maltophilia ATCC 13636 and P. aeruginosa ATCC 27853 were used as positive and negative control strains, respectively, in the MBL E- test.
Molecular Detection of NDM-1 Gene: All 25 isolates, which were confirmed phenotypically to be positive for MBL production by MBL E-Test, were subjected to PCR using group-specific primers to detect the NDM-1 gene. The primers used in the study are shown in Table 4.
DNA was extracted by boiling lysis method. A single colony was inoculated into 1 ml Luria bertani broth and incubated at 37 °C for 24 h. It was subjected to centrifugation at 10,000 rpm, 25 °C for 10 min. The pellet obtained was suspended with 500 µl milli-Q water and boiled at 100 °C for 10 min. It was then stored overnight at -20 °C. The next day it was subjected to centrifugation at 10,000 rpm, 25 °C for 10 min.
The supernatant was collected and used as the template for the PCR. The cycling conditions were as follows: denaturation at 94 °C for 10 min, followed by 35 amplification cycles (94 °C for 30 sec, 58.5 °C for 40 sec, 72 °C for 50 sec) and a final extension cycle (72 °C for 5 min). The DNA band patterns were evaluated by electrophoresis with 1.5% agarose gel in 1X TBE buffer. A 100 bp ladder molecular weight marker was used to measure the molecular weights of tested amplified products. The presence of bands of molecular weight of 621bp suggests the presence of the NDM-1 gene on gel electrophoresis 15.
Results:
Clinical Isolates: The results of the clinical isolates are presented in Table 1. A total of 126 clinical isolates were collected from tertiary care hospitals in Chennai, out of which 78 Multidrug-resistant isolates were screened for Carbapenemase and MBL production.
Phenotypic Detection of MBL Producers and their Confirmation:
Screening of Isolates for MBL Production, Imipenem-EDTA Combined Disc Test (CDT), Modified Hodge Test, MBL E – Test: The results of in-vitro antibiotic cultural sensitivity to different carbapenems are presented in Table 2. Majority of isolates (39.7%) were resistant to imipenem followed by ertapenem (35.9%). However, lower proportions of isolates were recorded resistant to doripenem (24.3%) in Table 2 / Fig. 1.
A total of 31/78 (39.7%) isolates of P. aeruginosa were resistant to one or both carbapenems (imipenem and ertapenem) used in the screening test. The Imipenem resistant isolates 31 (39.7%) exhibited a zone size enhancement of ≥ 7 mm in the combined disc test Table 3/Fig. 1. Majority (60.3%) isolates were non-MBL producers.
Out of 78 isolates, 27 (34.6%) and 25 (32.1%) isolates were MHT positive and MBL producers by Modified Hodge Test (MHT) and MBL E-Strip test respectively Table 3/Fig. 2 & 3. S. maltophilia ATCC 13636 and P. aeruginosa ATCC 27853 were used as positive and negative quality control strains.
Molecular Detection of NDM-1 Gene: The results of the molecular detection of the NDM-1 gene are presented in Table 5 /Fig. 4. PCR for detection of NDM-1 was carried out for 25 isolates. Out of 25 isolates, 7 (28%) isolates were positive, and 18 (72%) were negative for NDM-1 gene production.
TABLE 1: ISOLATION OF PSEUDOMONAS AERUGINOSA FROM VARIOUS CLINICAL ISOLATES
| S. no. | Clinical sample | Total number of isolates | Total percentage |
| 1 | Pus | 43 | 34.1% |
| 2 | Wound Swab | 21 | 16.6% |
| 3 | Cerebrospinal fluid (CSF) | 2 | 1.6% |
| 4 | Bronchoalveolar Lavage (BAL) | 4 | 3.1% |
| 5 | Endotracheal Aspirate (ETA) | 7 | 5.6% |
| 6 | Sputum | 15 | 12% |
| 7 | Blood | 9 | 7.1% |
| 8 | Ear swab | 13 | 10.3% |
| 9 | Urine | 7 | 5.6% |
| 10 | High Vaginal Swab (HVS) | 5 | 4% |
| Total | 126 | 100% | |
TABLE 2: IN-VITRO CULTURAL SENSITIVITY ASSAY USING CARBAPENEMS AGAINST P. AERUGINOSA ISOLATES
| S. no. | Antibiotics | Sensitive | Resistance |
| 1 | Imipenem | 47 (60.3%) | 31 (39.7%) |
| 2 | Ertapenem | 50 (64.1%) | 28 (35.9%) |
| 3 | Doripenem | 59 (75.7%) | 19 (24.3%) |
FIG. 1: ISOLATES SHOWING RESISTANCE TOWARDS CARBAPENEMS LEFT SIDE OF THE PLATE (IMIPENEM, ERTAPENEM, DORIPENEM). RIGHT SIDE OF THE PLATE (IMIPENEM -IMIPENEM +EDTA) IS POSITIVE FOR MBL BY PHENOTYPIC TEST (COMBINED DISC TEST)
FIG. 2: THE PRESENCE OF A DISTORTED OR CLOVER LEAF SHAPED INHIBITION ZONE IS A MHT POSITIVE DUE TO CARBAPENEMASE PRODUCTION BY THE TEST STRAIN
FIG. 3: A RATIO OF MICS OF THE MEROPENEM (MRP) TO MRP+EDTA OF ≥ 8 WAS INTERPRETED AS MBL POSITIVE
TABLE 3: PHENOTYPIC DETECTION OF METALLO-Β-LACTAMASE PRODUCING P. AERUGINOSA ISOLATES
| S. no | No. of isolates Multidrug-resistant | No. of isolates resistant to Imipenem | Combined disc test | Modified Hodge Test (MHT) test | E test |
| 1 | 78 | 31(39.7%) | 31(39.7%) | 27 (34.6%) | 25 (32.1%) |
TABLE 4: PRIMER SEQUENCE
| S. no. | Primer | Primer sequence (5’-3’) | Amplicon size (bp) |
| 1 | blaNDM-1-F | GGTTTGGCGATCTGGTTTTC | 621 bp |
| 2 | blaNDM-1-R | GGTTTGGCGATCTGGTTTTC | 621 bp |
TABLE 5: MOLECULAR DETECTION OF NDM-1 GENE
| S. no. | Total number of isolates tested for NDM-1 gene | Positive for NDM-1 gene | Negative for NDM-1 gene |
| 1 | 25 | 7(28%) | 18(72%) |
FIG. 4: AGAROSE GEL ELECTROPHORESIS (1.5%) REPRESENTS 621 BP BLANDM-1 GENE IN PSEUDOMONAS AERUGINOSA., LANE 1: 100BP DNA LADDER, LANE 2: POSITIVE CONTROL, LANE 3: NEGATIVE CONTROL, LANES 4 & 12: NEGATIVE ISOLATES FOR NDM-1 PRODUCTION (AMPLICON SIZE-621 BP); LANES 5-11: POSITIVE ISOLATES FOR NDM-1 PRODUCTION (AMPLICON SIZE-621 BP)
DISCUSSION: Pseudomonas aeruginosa is an opportunistic pathogen that causes serious infection in patients with weakened immune systems and it has become the important cause of nosocomial infections with a high mortality rate 16, 17.
It is predominantly responsible for emerging hospital-acquired infections and poses serious health concerns due to increased levels of multidrug resistance 18. P. aeruginosa is resistant to many classes of antimicrobial agents and can acquire resistance by mutation and horizontal transfer of resistance determinants. The risk of mortality and morbidity in infections caused by P. aeruginosa is increased due to wrong or delayed initial antibiotic therapy, especially when the infection is caused by multidrug-resistant pathogens 19, 20.
In our study total of 126 P. aeruginosa isolates were isolated from the following clinical samples Pus 43(34.1%), Wound Swab 21(16.6%), Cerebrospinal fluid (CSF) 2 (1.6%), Bronchoalveolar Lavage (BAL) 4 (3.1%), Endotracheal Aspirate (ETA) 7(5.6%), Sputum 15 (12%), Blood 9 (7.1%), Ear swab 13(10.3%), Urine 7(5.6%), High Vaginal Swab (HVS) 5 (4%). The highest numbers of isolates were obtained from the pus sample and the lowest from CSF. In a similar study carried out previously, 110 different organisms were isolated from a total of 170 clinical samples such as pus, urine blood, sputum, and drain fluid, and they reported 15.78% of isolates were P. aeruginosa and 57 (22.4%) isolates were isolated from 254 pus samples in a study carried out in Bathinda 21, 22. The occurrence of multidrug-resistant Metallo-β-lactamase P. aeruginosa isolates in a hospital setting is of concern as it poses a problem in therapy and infection control management. In our study, the prevalence of MBL-PA isolates was 39.7%.
Metallo-β-lactamase producing Pseudomonas aeruginosa is an important nosocomial pathogen that shows resistance to all β-lactam antibiotics except monobactam. In another study, they isolated 121 (96.1%) Pseudomonas aeruginosa out of 126 clinical isolates from the following samples, pus 35 (27.8%), urine 25 (19.84%), endotracheal aspirate 24 (19.04%), blood 14 (11.11%), and sputum 4 (3.17%) 23. Similarly, 21% of MBL positive P. aeruginosa were isolated from urine, wound swabs, sputum, blood, tissue aspirates, ear swab, and CSF samples in a study carried out in Sudan 24. While in a previous study in Jaipur, it was reported 20% 25. 18.37% isolates of P. aeruginosa were positive for MBL production from Uttarakhand 26. 41.3% of Pseudomonas aeruginosa isolates were screened positive for MBL production, which was reported from Bengaluru 27.
Similar to our study, the prevalence of MBL production was found to be 10% in India, 53.2% in Iran 28. 12% in Canada, 12.7% in the United Arab Emirates, 13.4% in Russia, 14% in Spain, 38.3% in São Luis of Brazil, 47.3% in Taiwan, and 62% in Greece 29,30. 93.75% isolates were MBL positive in a study carried out in Karim Nagar, and 20.3% were positive for MBL production in a study carried out in 2019 in Thailand 31, 32. In another study, 13.2% of isolates in Barabanki and 52% of isolates in Bahrain were found to be positive for MBL production 33, 34. Similarly, 39 isolates were screened by the combined disc and disc diffusion methods, and 64.1% were found to be MBL producers in Egypt 35. MBL was detected by a modified Hodge, and imipenem-EDTA double-disk synergy test and 14.4% isolates were positive for MBL production in Aligarh 36.
Resistance to carbapenem antibiotics in various Gram-negative bacteria suggests that they may be responsible for increased mortality. The emergence of resistance was associated with a significantly increased number of adverse outcomes 37. Carbapenems are the most effective antimicrobial agents against gram-positive and gram-negative bacteria, including P. aeruginosa. Carbapenems have the beta-lactam ring, and, like all other beta-lactams, they inhibit bacterial cell wall synthesis by binding to and inactivating Penicillin Binding Proteins (PBPs). This unique molecular structure offers them their exceptional stability to many beta-lactamases, including AmpC and most of the extended-spectrum beta-lactamases (ESBLs) 38. Pseudomonas aeruginosa isolates acquire resistance to carbapenems via several mechanisms including overexpression of efflux systems, change or lack of outer membrane proteins (such as OprD porin), chromosomal AmpC beta-lactamase, and production of carbapenemases 39.
A simple screening method using a combined disc diffusion test has been very useful to screen MBL positive isolates. We screened MBL producers among imipenem resistant isolates by three methods, the Combined Disc Test (CDT), Modified Hodge test (MHT), and E - strip test for MBL screening and found that majority of isolates (39.7%) were resistant to imipenem followed by ertapenem (35.9%) and doripenem (24.3%). A total of 31/78 (39.7%) isolates of P. aeruginosa were resistant to one or both carbapenems (imipenem and ertapenem) used in the screening test. The Imipenem resistant isolates 31 (39.7%) exhibited a zone size enhancement of ≥ 7mm in the combined disc test.
The majority (60.3%) isolates were non-MBL producers. Out of 78 isolates, 27 (34.6%) and 25 (32.1%) isolates were MHT positive and MBL producers by Modified Hodge Test (MHT) and MBL E-Strip test, respectively. Based on another study carried out previously for the screening of MBL production, 66 isolates were screened positive. The prevalence of MBL producing isolates of P. aeruginosa was 15% (24/160) based on the E-test result. MHT showed the highest sensitivity (87.5%), followed by CDT (79.2%), while specificity was highest for DDST (100%), followed by PT (95.2%). Out of 24 MBL producers, 15 isolates (62.5%) were resistant to both imipenem (IPM) and meropenem 27. It is lower in incidence as compared to our study. Similarly, 94.6% of carbapenemase production in P. aeruginosa isolates were reported in Delhi 23. In a previous study, 28.17% of isolates in Iran and 16.08% of isolates in Barabanki were found to be carbapenem resistant P. aeruginosa 40, 33. While in a previous study in Egypt, it was reported 26.5% 35. In a retrospective cohort study carried out in Pittsburgh Medical Centre, they reported a 19% mortality rate in patients with bacteremia is due to carbapenem-resistant (CR) Pseudomonas aeruginosa 41. In this study, out of 25 isolates, 7 (28%) isolates were positive, and 18 (72%) were negative for the NDM-1 gene. Similarly, 46.06% isolates in Delhi, 3.91% isolates in Barabanki, 2.5% isolates in Bahrain, and 10.4% isolates in Singapore were found to be positive for the production of NDM-1 gene 23, 33, 34, 42. In another study carried out in Iraq during 2018. They reported the emergence of Pseudomonas aeruginosa carrying NDM-1 gene variants, which exhibited resistance to imipenem and meropenem for the first time in Iraq 43.
CONCLUSION: The prevalence of multidrug-resistant Pseudomonas aeruginosa infections leads to a worldwide increase in the occurrence of MBL-PA, which is alarming. A high rate of the NDM-1 gene producer was noted among Multidrug-resistant Pseudomonas aeruginosa. Apart from performing the only antimicrobial sensitivity tests, phenotypic and molecular screening should also be employed regularly to find out the actual number of the NDM-1 resistance gene and for proper diagnosis and management of all P. aeruginosa infections.
ACKNOWLEDGEMENT: Nil
CONFLICTS OF INTEREST: The authors declare no conflicts of interest.
REFERENCES:
- Laupland KB, Parkins MD, Church DL, Gregson DB, Louie TJ, Conly JM, Elsayed S and Pitout JD: Population-based epidemiological study of infections caused by carbapenem-resistant Pseudomonas aeruginosa in the Calgary Health Region: importance of metallo-beta-lactamase (MBL)-producing strains. J Infect Dis 2005; 192(9): 1606-12.
- Memish Z, Shibl A, Kambal A, Ohaly Y, Ishaq A and Livermore D: Antimicrobial resistance among non-fermenting Gram-negative bacteria in Saudi Arabia. Journal of Antimicrobial Chemotherapy 2012; 67(7): 1701-05.
- Walsh T, Toleman M, Poirel L and Nordmann P: Metallo-β-Lactamases: the Quiet before the Storm?. Clinical Microbiology Reviews 2005; 18(2): 306-25.
- Pitout J, Gregson D, Poirel L, McClure J, Le P and Church D: Detection of Pseudomonas aeruginosa Producing Metallo- -Lactamases in a Large Centralized Laboratory. Journal of Clinical Microbiology 2005; 43(7): 3129-35.
- Irfan S, Zafar A, Guhar D, Ahsan T and Hasan R: Metallo-β-lactamase-producing clinical isolates of Acinetobacter species and Pseudomonas aeruginosa from intensive care unit patients of a tertiary care hospital. Indian J Med Microbiol 2008; 26(3):243.
- Giamarellou H and Poulakou G: Multidrug-Resistant Gram-Negative Infections. Drugs 2009; 69(14):1879–901.
- Tenover FC: Mechanisms of Antimicrobial Resistance in Bacteria. The American J of Medicine 2006; 119(6): 3-10.
- Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, Chaudhary U, Doumith M, Giske CG, Irfan S, Krishnan P, Kumar AV, Maharjan S, Mushtaq S, Noorie T, Paterson DL, Pearson A, Perry C, Pike R, Rao B, Ray U, Sarma JB, Sharma M, Sheridan E, Thirunarayan MA, Turton J, Upadhyay S, Warner M, Welfare W, Livermore DM and Woodford N: Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis 2010; 10(9): 597-02.
- Rolain M, Parola P and Cornaglia G: New Delhi metallo-beta-lactamase (NDM-1): towards a new pandemia?. Clinical Microbiology and Infection 2010; 16(12): 1699-01.
- Sundararaj T: Microbiology Laboratory Manual. IBMS, University of Madras, Tharamani, Chennai 1997; 48-62.
- Kirby WM, Bauer AW, Sherris JC and Turek M: Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Path1966; 45: 493-96.
- Clinical laboratory standards institute: “Performance standards for antimicrobial susceptibility testing,” Twenty second informational supplement, CLSI document M100 - S 22, 32, 2013.
- Lee K, Lim YS, Yong D, Yum JH and Chong Y: Evaluation of the hodge test and the imipenem-EDTA double-disk synergy test for differentiating metallo-lactamase producing isolates of pseudomonas spp. and acinetobacter spp. Journal of Clinical Microbiology 2003; 41(10): 4623-9.
- Maria PD and Sindhura JPR: Study on detection of carbapenemases in clinical isolates of family Enterobacteriaceae. International Journal of Scientific Research and Management 2015; 3(3): 119-25.
- Govindan R, Muthuchamy M, Govindan R, Muthu P and Natesan M: Detection of ESBL genes from ciprofloxacin resistant Gram negative bacteria isolated from urinary tract infections (UTIs). Front in Labo Medi 2018; 2(1): 5-13.
- Shanmugasundaram P, Sah SK, Rasool U, Gowri SM, Easwaramoorthy D and Hemalatha S: Novel curcumin analogs act as antagonists to control nosocomial infection causing Pseudomonas aeruginosa. Biocatalysis and Agricultural Biotechnology 2019; 20: 1878-81.
- Acharya M, Joshi PR, Thapa K, Rajan A, Trishna K and Supriya S: Detection of metallo-β-lactamases-encoding genes among clinical isolates of Pseudomonas aeruginosa in a tertiary care hospital, Kathmandu, Nepal. BMC Res Notes 2017; 10: 718-22.
- Sidra S and Habib B: Resistance profile of genetically distinct clinical Pseudomonas aeruginosa isolates from public hospitals in central Pakistan. Journal of Infection and Public Health 2020; 13(4): 598-05.
- Rezai MS, Ahangarkani F, Rafiei A, Hajalibeig A and Bagheri NM: Extended-spectrum beta-lactamases producing Pseudomonas aeruginosa isolated from patients with ventilator associated nosocomial infection. Arch Clin Infect Dis 2018; 13(4): 13974.
- Farhan SM, Ibrahim RA, Mahran KM, Hetta HF and Abd El-Baky RM: Antimicrobial resistance pattern and molecular genetic distribution of metallo-β-lactamases producing Pseudomonas aeruginosa isolated from hospitals in Minia, Egypt. Infect Drug Resist 2019; 12: 2125-33.
- Nazeen S, Mukta K, Santosh C and Borde A: Bacteriological trends and antibiotic susceptibility patterns of clinical isolates at Government Cancer Hospital, Marathwada. Indian J Cancer 2016; 53: 583-6.
- Jaswinder S, Surinder S, Amarjit KG and Amandeep K: Prevalence and antimicrobial susceptibility pattern of Pseudomonas aeruginosa isolated from pus samples in a tertiary care hospital, Bathinda. International Journal of Contemporary Medical Research 2016; 3(12): 3481-83.
- Bajpai V, Govindaswamy A, Khurana S, Batra P, Aravinda A, Katoch O, Hasan F, Malhotra R and Mathur P: Phenotypic and genotypic profile of antimicrobial resistance in Pseudomonas species in hospitalized patients. Indian J Med Res 2019; 149: 216-21.
- Adam MA and Elhag WI: Prevalence of metallo-β-lactamase acquired genes among carbapenems susceptible and resistant Gram-negative clinical isolates using multiplex PCR, Khartoum hospitals, Khartoum Sudan. BMC Infect Dis 2018; 18(1): 668.
- Choudhary V, Pal N and Hooja S: Prevalence and antibiotic resistance pattern of Metallo-β-lactamase-producing Pseudomonas aeruginosa isolates from clinical specimens in a tertiary care hospital. J Mahatma Gandhi Inst Med Sci 2019; 24: 19-22.
- Sachdeva R, Sharma B and Sharma R: Evaluation of different phenotypic tests for detection of metallo-β-lactamases in imipenem-resistant Pseudomonas aeruginosa. Journal of laboratory physicians 2017; 9(4): 249-53.
- Ranjan S, Banashankari GS and Babu PR: Evaluation of phenotypic tests and screening markers for detection of metallo-β-lactamases in clinical isolates of Pseudomonas aeruginosa: A prospective study. Med J DY Patil Univ 2015; 8: 599-05.
- Saderi H and Owlia P: Detection of multidrug resistant (MDR) and extremely drug resistant (XDR) Pseudomonas aeruginosa isolated from patients in Tehran, Iran. Iran J Pathol 2015; 10: 265-71.
- Murugan NA, Malathi J, Therese KL and Madhavan HN: Antimicrobial susceptibility and prevalence of extended spectrum β-lactamase (ESBL) and metallo-β-lactamase (MBL) and its co-existence among Pseudomonas aeruginosa recovered from ocular infections. Int J Pharm Pharm Sci 2015; 7: 147-51.
- Akya A, Salimi A, Nomanpour B and Ahmadi K: Prevalence and clonal dissemination of metallo-β-lactamase producing Pseudomonas aeruginosa in Kermanshah. Jundishapur J Microbiol 2015; 8(7): e20980.
- Amar CS, Sachin RG and Aparna B: Prevalence of MBL producing Pseudomonas aeruginosa in various clinical specimens in tertiary care hospital, Karimnagar. Tropical Journal of Pathology and Microbio 2019; 5(4): 205-09.
- Khuntayaporn P, Yamprayoonswat W, Yasawong M and Chomnawang MT: Dissemination of Carbapenem-Resistance among Multidrug Resistant Pseudomonas aeruginosa carrying Metallo-Beta-Lactamase Genes, including the Novel blaIMP-65 Gene in Thailand. Infection & Chemotherapy 2019; 51(2): 107-18.
- Agarwal A, Mohan S, Maheshwari U, Jain S and Akulwar SL: Prevalence of New Delhi metallo-β-lactamase-1 in Pseudomonas aeruginosa and its antimicrobial resistance profile in hospitalized patients in a tertiary care hospital setup. Int J Health Allied Sci 2018; 7: 250-5.
- Joji RM, Al-Rashed N, Saeed NK and Bindayna KM: Detection of VIM and NDM-1 metallo-beta-lactamase genes in carbapenem-resistant Pseudomonas aeruginosa clinical strains in Bahrain. J Lab Physicians 2019; 11(2): 138-43.
- Hashem H, Hanora A, Abdalla S, Shawky A and Saad A: Carbapenem Susceptibility and Multidrug-Resistance in Pseudomonas aeruginosa Isolates in Egypt. Jundishapur J Microbiol 2016; 9(11): e30257.
- Gupta R, Malik A, Rizvi M and Ahmed SM: Incidence of multidrug-resistant pseudomonas spp. in ICU patients with special reference to ESBL, AMPC, MBL and biofilm production. J Global Infect Dis 2016; 8: 25-31.
- Persoon MC, Anne in ‘t holt FV, Maurits PA, Meer V, Karen CB, Diederik G, Margreet CV and Juliëtte AS: Mortality related to Verona Integron-encoded Metallo-β-lactamase-positive Pseudomonas aeruginosa: assessment by a novel clinical tool. Antimicrob Resist Infect Control 2019; 8:107.
- Meletis G, Exindari M, Vavatsi N, Sofianou D and Diza E: Mechanisms responsible for the emergence of carbapenem resistance in Pseudomonas aeruginosa. Hippokratia 2012; 16(4): 303-07.
- Ghasemian A, Salimian RK, Rajabi VH and Nojoomi F: Prevalence of Clinically Isolated Metallo-beta-lactamase-producing Pseudomonas aeruginosa, Coding Genes, and Possible Risk Factors in Iran. Iran J Pathol 2018; 13(1): 1-9.
- Dogonchi AA, Ghaemi EA, Ardebili A, Yazdansetad S and Pournajaf A: Metallo-β-lactamase-mediated resistance among clinical carbapenem-resistant Pseudomonas aeruginosa isolates in northern Iran: A potential threat to clinical therapeutics. Tzu Chi Med J 2018; 30: 90-6.
- Buehrle DJ, Shields RK, Clarke LG, Potoski BA, Clancy CJ and Nguyen MH: Carbapenem-Resistant Pseudomonas aeruginosa Bacteremia: Risk Factors for Mortality and Microbiologic Treatment Failure. Antimicrob Agents Chemother 2016; 61(1): e01243-16.
- Ka LC, Sophie O, Oon TN, Kalisvar M, Indumathi V, Bernadette C, Raymond TPL and Jeanette WPT: Challenge of drug resistance in Pseudomonas aeruginosa: clonal spread of NDM-1-positive ST-308 within a tertiary hospital. J of Antimicro Chemothera 2019; 74(8): 2220-24.
- Ismail SJ and Mahmoud SS: First detection of New Delhi metallo-β-lactamases variants (NDM-1, NDM-2) among Pseudomonas aeruginosa isolated from Iraqi hospitals. Iran J Microbiol 2018; 10(2): 98-03.
How to cite this article:
Siddiqui SA, Noorjahan CM and Arunagirinathan N: Phenotypic and molecular detection of carbapenemase New Delhi metallo beta lactamase-1 (NDM-1) gene among Pseudomonas aeruginosa from various clinical isolates. Int J Pharm Sci & Res 2020; 11(11): 5856-63. doi: 10.13040/IJPSR.0975-8232.11(11).5856-63.
All © 2013 are reserved by the International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
62
5856-5863
735
1624
English
IJPSR
S. A. Siddiqui *, C. M. Noorjahan and N. Arunagirinathan
P.G. & Research Department of Zoology, Justice Basheer Ahmed Sayeed College For Women, Teynampet, University of Madras, Chennai, Tamil Nadu, India.
sheebaalisiddiqui90@gmail.com
13 September 2020
10 October 2020
19 October 2020
10.13040/IJPSR.0975-8232.11(11).5856-63
01 November 2020









