PREVALENCE OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) IN CLINICAL SPECIMENS AND AMONG HOSPITAL STAFF NASAL CARRIERS IN KHARTOUM STATE
HTML Full TextPREVALENCE OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) IN CLINICAL SPECIMENS AND AMONG HOSPITAL STAFF NASAL CARRIERS IN KHARTOUM STATE
Ehssan H. Moglad 1, 2
Department of Pharmaceutics 1, College of Pharmacy, Prince Sattam bin Abdulaziz University, P. O. Box 173 Alkharj 11942, Saudi Arabia.
Department of Microbiology 2, Medicinal and Aromatic Plants and Traditional Medicine Research Institute (MAPTMRI), P.O. Box 2404, National Center for Research, Khartoum, Sudan.
ABSTRACT: Staphylococcus aureus is a bacteria that causes a heavy epidemic disease burden worldwide. This study aimed to investigate the prevalence of Methicillin-Resistant Staphylococcus aureus (MRSA) and the presence of mecA gene as a virulence factor of S. aureus isolates from clinical isolates and hospital staff nasal carriers using a conventional PCR. A cross-sectional study involving eighty-one S. aureus isolates, 60 clinical isolates, and 21 nasal swabs from hospital staff was conducted from January 2018 to April 2018. The samples were processed using standard microbiological procedures. The antibiotic resistance pattern was performed using the Kirby- Bauer disc diffusion method for cefoxitin (30 μg), Oxacillin (5 μg), Gentamicin (10 µg), Ciprofloxacin (5 µg), amoxicillin-clavulanate (20 + 10 μg), fusidic acid (10 μg) and Vancomycin (30 µg) according to the Clinical and Laboratory Standards Institute guidelines. The presence of the mecA gene in MRSA was detected by PCR. A total of 60 clinical samples were collected and analyzed; 42 (70%) resulted in Methicillin resistant and positive for mecA gene, and 18 (30%) isolates resulted in sensitive for Methicillin and negative for mecA presence. All samples from hospital staff were resistant for Methicillin and positive for mecA presence. The MRSA became resistant to methicillin due to an acquisition of the mecA gene. All isolated S. aureus strains among the hospital staff nasal carriers were MRSA may influence the spread of bacteria and increase the percentage of persistent nosocomial infections in hospitalized patients. More studies needed in order to understand the molecular characterization of MRSA in a setting better using different molecular typing tools.
| Keywords: |
MRSA, Khartoum State, mecA, MSSA, Sudan
INTRODUCTION: Staphylococcus aureus is a major human pathogen that causes a spectrum of infections; it has been increasingly problematic worldwide 1-5.
S. aureus is reported as the second driving cause of nosocomial infections, especially in patients undergoing surgery, hemodialysis, cirrhosis, kidney transplant, and hospitalized patients 6-8.
Methicillin-resistant Staphylococcus aureus (MRSA) is a severe public health concern, responsible for hospital and community-associated infections worldwide 7, 9-11. MRSA infections are considered among the most life-threatening infections due to the limited therapeutic options 4, 5, 12, 13. A systematic review of MRSA in Africa 13.8 billion attributed to community-acquired MRSA 14. Methicillin resistance is encoded by the mecA gene, borne on the staphylococcal cassette chromosome mec (SCCmec). The mecA gene codes for a78-kD a penicillin-binding protein (PBP2a), with decreased affinity to methicillin as well as all beta-lactam antibiotics 15-17. Variable SCCmec types are circulating within different countries, reflecting the various MRSA strains 2, 18.
In Sudan, there is limited data on the prevalence of S. aureus in clinical samples and their resistance factors using molecular methods. This study aimed to screen the methicillin resistance gene (mecA) in S. aureus isolates from patients as well as health care workers. The findings from this study will contribute to the current knowledge on the prevalence and diversity of MRSA in Khartoum State.
MATERIALS AND METHODS:
Study Area and Clinical Isolates Collection: This study was a cross-sectional study conducted from January to May 2018. Sixty S. aureus clinical isolates were collected from Al Ribat Hospital, Bahri Hospital, Soba Hospital in Khartoum State. And Twenty-one nasal swabs were collected from health care workers and regarded as healthy carriers.
S. aureus Identification: The bacterial isolates were collected and identified according to standard biochemical tests 19, which included morphological characteristics on sheep blood agar, gram stain, catalase, coagulase, deoxyribonuclease (DNase), and mannitol fermentation tests.
Cefoxitin Disc Screen Test for Detection of MRSA: Susceptibility profile of S. aureus isolates to cefoxitin (30μg) was implemented by the disc diffusion method on Mueller-Hinton agar plates. Bacterial suspension prepared on physiological saline and suspension turbidity equivalent to a 0.5 McFarland standard. Plates were incubated at 35°C for 24 h. According to CLSI guidelines, the interpretive criteria for cefoxitin were: S. aureus, sensitive≥22 mm, and resistant ≤21 mm. In contrast, MRSA was resistant to cefoxitin disc. Staphylococcus aureus ATCC BAA 2313 was used as a positive control for MRSA, and Staphylococcus aureus ATCC BAA 1026 was used as a quality control each time the tests were performed 20.
Antibiotics Susceptibility Testing: Susceptibility testing was performed on all S. aureus isolates using the Kirby- Bauer disc diffusion method to antibiotics from different categories, namely: Oxacillin (5 μg), Gentamicin (10µg), Ciprofloxacin (5µg), amoxicillin-clavulanate (20 + 10 μg), fusidic acid (10μg) and Vancomycin (30µg) (Himedia, India). This method was performed on Mueller-Hinton agar (Himedia, India) following the performance standards for antimicrobial susceptibility testing recommended by the Clinical and Laboratory Standards Institute guidelines 20. ATCC 29213 Staphylococcus aureus strain was used for quality control for minimal antimicrobial susceptibility quality control testing.
DNA Extraction and PCR Detection of the Methicillin Resistance (mec A) Gene: DNA was extracted from all isolates using the Chelex method as previously described 21, 22. The presence of the mecA gene was tested using conventional PCR. Briefly, 5 μl of template DNA was added to the PCR mixture containing a 1X master mix and 50 pmol of the forward and reversed mecA primers mecA F-GTAGAAATGACTGAACGTCCGATGA and mecA R-'CCAATTCCACATTGTTTCGGTCT AA'. Nuclease-free water was added to reach a final reaction volume of 50 μl. The optimal cycling conditions were as follows: initial denaturation 4 min at 94 ºC; 35 cycles of 45s denaturation at 94 ºC, annealing for 45s at 50 ºC, an extension for the 60s at 72 ºC, and final extension for 2 min at 72 ºC, performed on a Bio-Rad automatic thermal cycler. PCR performed in duplicates for each sample. The PCR products were resolved through gel electrophoresis (1.5% TBE agarose gel) to check for the specific product size of 310 pb. PCR products visualized under ultraviolet light (Transilluminator; Uvite, UK) Fig. 1.
Statistical Analysis: Data were analyzed using statistical package for social sciences (SPSS), version 25 (IBM, SPSS Inc., Chicago, IL). Descriptive data were presented as a percentage.
Ethical Approval: This study was carried out after ethical approval from the Institutional Ethics Committee, Deanship of Scientific Research, Sudan University of Science and Technology. All participants were informed in detail before recruiting them, and the participation was voluntary, and informed consent was obtained from each participant prior to the start of this study.
RESULTS:
Phenotypic Detection of MRSA: A total of 60 clinical samples were collected and, and 43 (71.67%) resulted resistant for cefoxitin disc, while the 17 (28.33%) remains isolates resulted sensitive for cefoxitin. All nasal swabs from hospital staff were resistant to cefoxitin.
S. aureus Antimicrobial Susceptibility Testing: Out of eighty-one isolate; 68 (83.9%) were resistant to Amoxicillin-clavulanate, followed by Oxacillin with resistant rate 64 (79.0%), while, S. aureus was most sensitive to Vancomycin 47(59.3%) Table 1.
TABLE 1: ANTIMICROBIAL RESISTANT RAT FOR ALL S. AUREUS
| Classes of antibiotics | Name of Antibiotic | Count (%) |
| Fluoroquinolones | Ciprofloxacin | 41 (50.6) |
| Aminoglycosides | Gentamicin | 42 (51.9) |
| Glycopeptide | Vancomycin | 33 (40.7) |
| Penicillins | Oxacillin | 64 (79.0) |
| β-lactam/β-lactamase inhibitor complexes | Amoxicillin-clavulanate | 68 (83.9) |
| Fusidane | Fusidic acid | 48 (59.3) |
| Muti-drug reistant MDR | 60 (74.1) | |
Key: The result interpreted according to CLSI guideline, N = 81.
PCR Detection of the Methicillin Resistance (mecA) Gene: Out of 81 S. aureus isolates, all clinical isolates and nasal swabs from hospital staff were identified as MRSA were positive for the mecA gene with the frequency rate of 64 (79.0%).
FIG. 1: A REPRESENTATIVE AGAROSE GEL ELECTROPHORESIS OF PCR PRODUCTS AFTER AMPLIFICATION OF THE mecA GENE. Lanes: 1- 7 positives mecA PCR products and (M) a molecular weight marker (O’Range Ruler 100 DNA Ladder, SM1143-Fermentas)
DISCUSSION: The prevalence of MRSA is high among clinical isolate and hospital staff nasal carriers who could consider as a potential source for the spread of resistant strains in nosocomial infection. This finding, like the previous studies, reported out that isolated S. aureus strains among the staff nasal carriers may lead to an increase the persistent nosocomial infections in hospitalized patients and also health care workers 1, 7.
In Africa, this study revealed a high prevalence of MRSA (79%), which was near to the prevalence rate in Egypt (82%), and unlike with the low prevalence (7%) reported in Madagascar 14. The MRSA prevalence has been shown to vary across different countries; this marked variation might be due to different environmental determinants or only due to a difference in the genetic diversity of S. aureus 18. For instance, in Kenya, there is a marked difference in reported MRSA prevalence in clinical isolates within Nairobi, with one recent study reporting a prevalence of 3.7% while another reported 87.2% 23, 24. This finding was more than other studies in Saudi Arabia reported that the MRSA rate was 32% 25-27.
This study also reported the high resistant rate to other antibiotics from different categories used to treat the S. aureus infection. The highest resistance rate to Amoxicillin-clavulanate followed by Oxacillin; this is considered that β-lactam/β-lactamase inhibitor complexes and penicillins are not very active in the treatment. In contrast, vancomycin showed the highest sensitivity rate (59.3%) among all S. aureus, which means it still can be chosen as a therapeutic agent against S. aureus strains. This vancomycin sensitive rate was higher than other studies finding from Egypt that stated the sensitive rate of 45.5% 28. Also, disagree with the study from Ethiopia stated that the percentage of VRSA was 65.1% 29. While the other study from Tehran described that out of 1789 S. aureus, only four VRSA were noticed 30.
In this study S. aurues identified as Multi-drug resistant MDR when it developed resistant to at least one agent in three or more antimicrobial groups 31. In overall, the increase in the resistance of isolated organisms to Penicillins, Fluoro-quinolones, Aminoglycosides, Glycopeptide, β-lactam/β-lactamase inhibitor complexes and Fusidane in this study might be due to an increase in the usage of these antibiotic’s classes in the hospital. The results of this study showed that 74.1% of the strains were resistant to more than two antibiotics, so due to the spread of MDR strains, this may become a significant challenge for the treatment process. This MDR situation might be due to acquiring of several resistant genes through R plasmid 32. Furthermore, throughout the latest several decades, the incidence of MDR organisms in hospitals and health centers has increased steadily. So, this study reported the developments of multi-drug resistance among S. aureus and illustrative an alarming threat of the appearance of multi-drug resistant pathogens.
This study illustrated that all resistant bacteria have mecA gene; this agreed with previous studies demonstrated it as a possible cause of bacteria to be resistant for Methicillin, which was by the acquisition of mecA gene 4, 5, 12, 13. The methicillin-resistant gene (mecA) plays a significant role in the resistance to lactam antibiotics. Because of its resistance to multiple antibiotics, MRSA is challenging to eliminate 10. This study entirely agrees with previous studies which they reveal a markedly heterogeneous population of SA isolates 15, 16, 33.
CONCLUSION: This study has demonstrated that the prevalence of MRSA and MDR strains was high, also has revealed that in order to increase the accuracy of the identification results of MRSA, next to the detection of the methicillin resistance gene (mecA) by PCR. It is also essential to characterize the S. aureus strains using different molecular typing tools as well as we need for continuous surveillance in order to keep track of emerging clones.
ACKNOWLEDGEMENT: This publication was supported by the Deanship of Scientific Research at Prince Sattam bin Abdulaziz University, Alkharj, Saudi Arabia.
CONFLICTS OF INTEREST: The authors declare that they have no competing interests.
REFERENCES:
- Control, C.f.D. & Prevention. Active bacterial core surveillance report, emerging infections program network, methicillin resistant Staphylococcus aureus, 2014. http://www. cdc. gov/abcs/reports-findings/survreports/ mrsa14. html For more information, visit our web sites: http://www. cdc. gov/abcs/index. html, http://www. cdc. gov/mrsa Last Updated: Mar1, 2016 (2014).
- Deurenberg RH: The molecular evolution of methicillin-resistant Staphylococcus aureus. Clinical Microbiology and Infection 2007; 13: 222-35.
- Huttenhower C: Structure, function and diversity of the healthy human microbiome. Nature 2012; 486: 207.
- Metersky ML: The Prevalence and Significance of Staphylococcus aureus in Patients with Non-Cystic Fibrosis Bronchiectasis. Ann Am Thorac Soc 2018; 15: 365-70.
- Rodríguez-Noriega E: Evolution of methicillin-resistant Staphylococcus aureus clones in Latin America. International Journal of Infectious Diseases 2010; 14: e560-e566.
- Du J: Molecular characterization and antimicrobial susceptibility of nasal Staphylococcus aureus isolates from a Chinese medical college campus. PLoS One 2011; 6: e27328.
- Sabbagh P: Molecular characterization of Staphylococcus aureus strains isolated among hospital staff nasal carriers of Babol, Iran. Caspian Journal of Internal Medicine 2017; 8: 311-16.
- Vandenesch F, Lina G and Henry T: Staphylococcus aureus hemolysins, bi-component leukocidins, and cytolytic peptides: a redundant arsenal of membrane-damaging virulence factors? Front Cell Infect Microbiol 2012; 2: 12.
- Vandenesch F: Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerging Infectious Diseases 2003; 9: 978.
- Enright MC: The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proceedings of the National Academy of Sciences 2002; 99: 7687-92.
- Moglad EHO, Boon SKA and Ali HTO: Various medicinal plants: a promising treatment for multidrug-resistant bacteria isolated from wound infection. International Journal of Pharmaceutical Sciences and Research 2020; 11: 839-43.
- Pan SC: Epidemiology and staphylococcal cassette chromosome mec typing of methicillin-resistant Staphylococcus aureus isolates in Taiwan: A multicenter study. Journal of the Formosan Medical Association 2014; 113: 409-16.
- Kottler S, Middleton JR, Perry J, Weese JS and Cohn LA: Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus carriage in three populations. J Vet Intern Med 2010; 24: 132-9.
- Abdulgader SM, Shittu AO, Nicol MP and Kaba M: Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review. Frontiers in Microbiology 2015; 6: 348-48.
- Yu Y: Dissemination and molecular characterization of Staphylococcus aureus at a Tertiary Referral Hospital in Xiamen City, China. BioMed Research International 2017; 9.
- Sadeghi J and Mansouri S: Molecular characterization and antibiotic resistance of clinical isolates of methicillin-resistant Staphylococcus aureus obtained from Southeast of Iran (Kerman). Apmis 2014; 122: 405-11.
- Hiramatsu K, Cui L, Kuroda M and Ito T: The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol 2001; 9: 486-93.
- Omuse G: Molecular characterization of Staphylococcus aureus isolates from various healthcare institutions in Nairobi, Kenya: a cross sectional study. Annals of Clinical Microbiology and Antimicrobials 2016; 15: 51.
- Cowan ST, Barrow GI, Steel KJ and Feltham RKA: Cowan and Steel's Manual for the Identification of Medical Bacteria (Cambridge University Press, 2004).
- Pereferance standard for antimicrobial suscept-ability testing. CLSI suplement M 10027th edu (2017).
- Zaborina O: Identification of multi-drug resistant Pseudomonas aeruginosa clinical isolates that are highly disruptive to the intestinal epithelial barrier. Annals of Clinical Microbiology and Antimicrobials 2006; 5: 14.
- Sabat G, Rose P, Hickey WJ and Harkin JM: Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl Environ Microbiol 2000; 66: 844-9.
- Omuse G, Kabera B and Revathi G: Low prevalence of methicillin resistant Staphylococcus aureus as determined by an automated identification system in two private hospitals in Nairobi, Kenya: a cross-sectional study. BMC Infect Dis 2014; 14: 669.
- Maina EK, Kiiyukia C, Wamae CN, Waiyaki PG and Kariuki S: Characterization of methicillin-resistant Staphylococcus aureus from skin and soft tissue infections in patients in Nairobi, Kenya. Int J Infect Dis 2013; 17: e115-9.
- Shibl AM: National surveillance of antimicrobial resistance among Gram-positive bacteria in Saudi Arabia. J Chemother 2014; 26: 13-8.
- Al-Humaidan OS, El-Kersh TA and Al-Akeel RA: Risk factors of nasal carriage of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus among health care staff in a teaching hospital in central Saudi Arabia. Saudi Med J 2015; 36: 1084-90.
- Alhussaini MS: Methicillin-resistant Staphylococcus aureus nasal carriage among patients admitted at Shaqra General Hospital in Saudi Arabia. Pak J Biol Sci 2016; 19: 233-38.
- Al-Amery K: Vancomycin-resistant Staphylococcus aureus isolated from camel meat and slaughterhouse workers in Egypt. Antimicrobial Resistance & Infection Control 2019; 8: 129.
- Beyene T: Prevalence and antimicrobial resistance profile of Staphylococcus in dairy farms, abattoir and humans in Addis Ababa, Ethiopia. BMC Research Notes 2017; 10: 171.
- Shekarabi M, Hajikhani B, Chirani AS, Fazeli M and Goudarzi M: Molecular characterization of vancomycin-resistant Staphylococcus aureus strains isolated from clinical samples: A three year study in Tehran, Iran. PLOS ONE 2017; 12: e0183607.
- Magiorakos AP: Multidrug-resistant, extensively drug-resistant and pan drug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection 2012; 18: 268-81.
- Nikaido H: Multidrug resistance in bacteria. Annual Review of Biochemistry 2009; 78: 119-46.
- Thapaliya D: Prevalence and molecular characterization of Staphylococcus aureus in commercially available meat over a one-year period in Iowa, USA. Food Microbiology 2017; 65: 122-29.
How to cite this article:
Moglad EH: Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical specimens and among hospital staff nasal carriers in Khartoum state. Int J Pharm Sci & Res 2021; 12(1): 673-77. doi: 10.13040/IJPSR.0975-8232.12(1).673-77.
All © 2013 are reserved by the International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
76
673-677
591
1339
English
IJPSR
E. H. Moglad
Department of Pharmaceutics, College of Pharmacy, PrinceSattam bin Abdulaziz University, Alkharj, Saudi Arabia.
ehssanhassn@gmail.com
07 May 2020
05 September 2020
03 October 2020
10.13040/IJPSR.0975-8232.12(1).673-77
01 January 2021






