PRIMER DESIGNING AND STANDARDIZATION OF PRIMER ANNEALING TEMPERATURE FOR BETA-3-ADRENERGIC RECEPTOR IN MUS MUSCULUS
HTML Full TextPRIMER DESIGNING AND STANDARDIZATION OF PRIMER ANNEALING TEMPERATURE FOR BETA-3-ADRENERGIC RECEPTOR IN MUS MUSCULUS
Vijayalakshmi Gangadhara and Asha Abraham *
Department of Post Graduate Studies & Research in Biotechnology, St Aloysius College (Autonomous) - Affiliated to Mangalore University, Mangalore, Karnataka, India.
ABSTRACT: Adrenergic receptors (ADRs) are implemented in important pharmacological responses. The β3adrenergic receptors have been proposed as a suitable drug target for treating diabetes and obesity. However, very little information is available regarding the expression profile of β3 receptors. We have designed primers for studying the β3adrenergic receptors in C57BL/6J mice using various bioinformatics tools in the present study. The primers were designed using three different software, primer 3 Plus, NCBI Primer BLAST, and Primer express, and validated using UCSC in-silico PCR and NCBI -Primer-BLAST. The best primer pair was selected based on primer melting temperature, GC% and primer length. The selected primer pair was custom synthesized. The primer annealing temperature was standardised using gradient PCR. Among the three software used for primer designing, primer express was found to be the best, and the primers designed from primer express were found to have the ideal melting temperature between 58-60°C, 50% of GC content, and 20bp length. From gradient PCR, the primer annealing temperature was found to be 58.3°C. The bioinformatics tool is useful for the successful designing of primers. Primer express software is best among other software used to design qRT PCR-specific primer.
Keywords: Beta 3 adrenergic receptor, primer designing, In-silico PCR, qPCR
INTRODUCTION: Adrenergic receptors play a significant role in pharmacological reactions. They have 7 transmembrane domains (3 intracellular and 3 extracellular loops), a glycosylated N-terminal extracellular domain and a C-terminal intracellular domain, which is typical for GPCRs 1. Since, many developed drugs target a GPCRs, these receptors have been critical to pharmaceutical research.
Catecholamines such as epinephrine and norepinephrine are natural ligands for adrenergic receptors 2, 3, 4. Adrenergic receptors can be divided into two subfamilies, α and β adrenergic; these are classified based on the differences related to ligand specificity, tissue expression, downstream signaling and final cellular effects.
The beta (β)-adrenergic receptors, or -adrenoceptors, comprise three members: 1, 2 and 3, which are dispersed across different chromosomes. In terms of amino-acid sequence, β3-ADR is 50 and 40% homologous to β1- and β2 adrenergic receptors, respectively, with the main differences clustering at the 3rd intracellular loop and the C-terminal tail.
The β1 adrenergic receptor and β2 adrenergic receptor have an overall percent identity of 80% and nearly identical intracellular sequences 2, while intracellular sequences 3 exhibit the greatest length variability and have been implicated in G protein selectivity 5, 6. The β3 adrenergic receptor is mainly expressed in adipose tissue. It is responsible for increased lipolysis and thermogenesis in visceral adipose tissue (VAT) to modulate metabolic rates, as molecular abnormalities in the gene are related to the development of obesity and type 2 diabetes 7. More specifically, β3 adrenergic receptor acts through the UCP1 activation, reversing adipocyte dysfunction and promoting BAT thermogenesis. Therefore, β3adrenergic receptors have been proposed as a suitable drug target for the treatment of diabetes and obesity. Mice remain the most studied model organism in research 7, 8. Since this research's findings are typically extrapolated to humans, it is important to understand both similarities and differences between the two species. Besides the apparent difference in size and macroscopic organization of the organ in the two species, several aspects suit both species, which are evidently described. The β3 adrenergic receptor is a good drug target, and its expression is less studied in mice tissues. Quantitative RT-PCR (qRT-PCR) helps to study the expression of a gene. The primer plays an important role in the qPCR reaction. Designing the specific primer is a critical step as the efficient primer increases the sensitivity and reproducibility of the reaction. Thus, in the present study, we have designed and validated the primer pairs for β3 adrenergic receptors in Mus musculus.
MATERIALS AND METHODS:
Extraction of Nucleotide Sequence: The nucleotide sequence for β3 adrenergic receptor (Adrb3) for Mus musculus was queried in National Centre for Biological Information.
The gene sequence for the respective gene coding for selected hits was downloaded in FASTA format from NCBI.
Selection of Conserved Regions: The four selected transcript variants were compared using Clustal W from EMBL-EBI. The phylogenic tree derived from Clustal W was used to find the conserved regions. The highly conserved regions were selected for primer design.
Primer Designing: It was difficult to select the best tool for primer designing. Therefore, we opted for different software to design the primer. The primers were designed using three different software: primer 3 Plus, NCBI Primer-BLAST, and Primer express (Thermofisher Scientific). The conserved sequence was uploaded in each software separately. The parameters like product size, primer size, GC content, and melting temperature were set. The top primer pairs from each software were selected for further analysis.
Analysis of Secondary Structures: The best primer pairs from Primer 3 Plus, NCBI Primer-BLAST, and Primer Express were selected and checked for specificity using the IDT-DNA Oligo Analyzer. The secondary structures like hairpin, self-dimer, and heterodimers were analysed for the primer pairs.
In-silico PCR: The designed primers were subjected to in-silico PCR using UCSC in-silico PCR. The forward and reverse primers were uploaded. The genome and its assembly for the mouse were selected. The maximum product length was changed to 200bp, and the query was submitted. The expected product size of the primers was observed.
BLAST: BLAST is the most frequently used to calculate sequence similarity. The best primer pair was selected based on its specificity and secondary structure. The primer sequence was uploaded on the BLAST and was run to compare the biological information.
Standardization of Primer Annealing Temperature: The primer pairs were custom synthesized (Sigma). The PCR reaction mixture containing Taq buffer, 25 Mm dNTP (GeNeiTM), forward primer and reverse primer for Adrb3, Taq polymerase (GeNeiTM), and 50ng/µl template mouse cDNA was added. The PCR was performed on T100TMXR Thermal cycler Gradient PCR (BIO-RAD, USA) with its corresponding optimum annealing temperature. The reference housekeeping control was the β actin gene (Act B). Initial denaturation was set at 95°C for 5 minutes, then 94°C for 1 minute, followed by annealing at 55°C-60°C for 1 minute, extension at 72°C for 1 minute with 40 cycles and final stabilization at 72°C for 10 minutes. The PCR products were separated by the agarose gel electrophoresis and result was analyzed using molecular imager Gel Doc™XR+ Imaging system (BIO-RAD, USA) with image lab software.
RESULTS AND DISCUSSION: Polymerase chain reaction is used to amplify the desired DNA fragments. Recent advances in PCR have developed various amplification techniques with the help of fluorescent dyes, which is more accurate and faster. The use of non-specific or sequence-specific fluorescent signals in conjunction with RT-PCR can be used to quantify the amount of mRNA, DNA, or cDNA in sample 9. Non-specific detection uses fluorescent dyes like SYBR Green. SYBR has the potential to bind the double-stranded DNA and emit a fluorescent signal that is 1,000-fold greater than unbound SYBR Green 10. The PCR products can be influenced by various parameters such as working reaction condition which includes temperature, pH of the buffer, the efficiency of polymerase enzyme to bind and amplify the DNA, concentration of Mg+ ions and purity of DNA template 11. Designing the specific primer is a critical step as the efficiency of the primer increases the sensitivity and reproducibility of the reaction. The best pair of primers for qRT PCR have a melting point between 45 to 65ºC with length 18 to 25bp. It is very crucial to have a 45-50% of GC content without any secondary structures such as hairpin loop, self-dimers to avoid non-specific binding 12, 13, 14.
The tools of bioinformatics and in-silico PCR have been extensively useful for designing the β3 adrenergic receptor primers and in validating them. The nucleotide sequence was extracted from NCBI in FASTA format specific for Mus musculus. The FASTA format was used to carry out further alignment and primer designing. Three different transcript variants of β3 adrenergic receptors were obtained from NCBI Table 1.
TABLE 1: ACCESSION NUMBERS OF THE TRANSCRIPT VARIANTS OF Β3 ADRENERGIC RECEPTOR IN MUS MUSCULUS FROM NCBI. SOURCE: NCBI
| NM_013462.3 | Mus musculus adrenergic receptor, beta 3 (Adrb3), mRNA | 2795 bp |
| XM_030243247.1 | Mus musculus adrenergic receptor, beta 3 (Adrb3), transcript variant X4, mRNA | 3029 bp |
| XM_030243246.1 | Mus musculus adrenergic receptor, beta 3 (Adrb3), transcript variant X3, mRNA. | 2942 bp |
| XR_003947220.1 | Mus musculus adrenergic receptor, beta 3 (Adrb3), transcript variant X2, misc RNA. | 3276 bp |
It is suggested that when sequence variants are available, it is better to design the primer using conserved regions to avoid non-specific amplification. Clustal W was used to check for conserved regions that align three or more sequences and produce biologically and statistically meaningful multiple sequence alignments of divergent sequences 15, 16. Therefore, these 3 transcript variants were analyzed further to check the conserved regions by multiple sequence alignments using Clustal W Fig. 1.
FIG. 1: CLUSTAL W WITH MULTIPLE SEQUENCE ALIGNMENT, THE REGIONS HIGHLIGHTED WITH STARS ARE THE CONSERVED REGIONS
The consensus region highlighted with stars were selected for primer designing. The primer were designed using Primer 3 Plus, Primer Express and NCBI Primer BLAST. The best pairs were selected based on length, melting temperature and GC%. The primer pairs obtained from three different software were considered for oligo analysis. The selected primer pairs were analyzed in IDT-Oligo Analyzer to check the primer specificity, secondary structures such as hairpin, self-dimer and heterodimers.
The primer pairs with least secondary structure was selected for further analysis. The primer pair 2 has the least secondary structure compared to other two pairs. The forward primer sequence did not show any hairpin structure but formed a single self-dimer. The reverse primer sequence did not show any secondary structures. The presence of dimers has a negative effect on the PCR product. Dimers can be cross-dimers, in which the forward and reverse primers are annealed, or self-dimers, in which the forward primer anneals to another forward primer or a reverse primer anneals to another reverse primer, resulting in a non-specific PCR product or no product at all 14, 17.
Therefore, the hybridization of two primers should be avoided; thus, in the current study, secondary structures were avoided. Also, monovalent (sodium, potassium), divalent (magnesium) and polyvalent cations positively impact the stability of hybridized oligonucleotides 18, 19, 20. In the current study, the monovalent salt concentration was set to 50mM, which is considered to give a stable environment for Tm for the designed primers. Increasing the concentration of monovalent cations (Na +), up to 1-2 M could further stabilize the oligo’s. Studies reported that Quant Prime and AutoPrime can yield primers with higher specificity. The designed primers were then validated by in-silico PCR tool. UCSC In-Silico PCR works in indexing strategy. The melting temperature of the input primers was displayed at the end and calculated based on 50mM salt and 50nM annealing oligonucleotide concentration. In-silico PCR is all about the primer specificity 21, 22. The result from UCSC In-silico tool provides the target chromosomal coordinates and amplicon size followed by the input sequences of the forward and reverse primers. This tool's amplicon length was 185bp, and Adrb3 was identified as the target genomic region Fig. 2.
FIG. 2: UPSC IN-SILICO PCR SHOWING THE PREDICTED PRODUCT LENGTH OF 185BP FOR THE PRIMER
There was not much difference between the GC percent, oligo length, and melting temperature of the primer pairs. NCBI-BLAST uses a heuristic strategy to align and find empirical or a near-optimal match based on the similarity of the query sequence 23. BLAST alignment results showed more than 40 similar sequences.
FIG. 3: NUCLEOTIDE BLAST FOR THE PRIMER PAIR FOR ADRB3 SHOWING TOP HITS
TABLE 2: PRIMER PAIRS SELECTED FROM PRIMER 3 PLUS, PRIMER EXPRESS AND NCBI PRIMER BLAST RESPECTIVELY. TM: MELTING TEMPERATURE OF THE PRIMER, %GC: PERCENTAGE OF GUANINE AND CYTOSINE
| Sequence (5’- 3’) | Length (bp) | Tm (°C) | GC (%) | |
| Primer pair1 | TTGTCCTGGTGTGGATCGTG | 20 | 60.0 | 55 |
| TTGGAGGCAAAGGAACAGCA | 20 | 60.1 | 50 | |
| Primer pair2 | GCTTGATCCCCATCTTCTTG | 20 | 59.6 | 50 |
| TTCTGGAGCGTTGGAGAGTT | 20 | 60.0 | 50 | |
| Primer pair3 | GGAGGCAACCTGCTGGTAAT | 20 | 60.03 | 55 |
| CGTAACGCAAAGGGTTGGTG | 20 | 60.04 | 55 |
However, the query sequence was 100% similar to Mus musculus. Adrb3 mRNA was further confirmed by the E value close to zero, and query coverage was 100% Fig. 3 indicated that the sequence match was pure, and hence the match was significant. The BLAST results gave a similar result; this confirms that the designed primers were specific for the target sequence. From earlier studies, a comparison was done between BLAST and other software such as MPBLAST 24, BLAT 25 and miBLAST, showed that NCBI-BLAST is the robust program based on parameters such as E value which showed a better score and Word Size showing significance on the sensitivity and performance of the program 21, 24.
We designed a pair of Adrb3 primers for qRT PCR with the sequence; Forward primer: 5’-GCTTGATCCCCATCTTCTTG-3’ and reverse primer: 5’-TTCTGGAGCGTTGGAGAGTT-3’ with 50% GC content, 20bp primer length and melting temperatures 59.6ºC and 60.0ºC respectively.The designed primer pairs were custom synthesized. Using gradient PCR, the primer annealing temperature was validated. It is reported that the primer annealing temperature-Ta ranges between ±5°C from the melting temperature-Tm of the corresponding primer pair. From the standardisation of annealing temperature for primers, we found that the annealing temperature was 58.3°C and it was within the calculated range. The validated annealing temperature can be used further for q-RT PCR studies.
CONCLUSION: The best primer pair for β3 adrenergic receptor in Mus musculus was designed using Primer Express software, which helps design primers with least or no secondary structures. The primers were successfully validated by wet lab experiments using mice cDNA. The primer annealing temperature will be used in the quantitative real-time PCR to study the gene expression pattern.
ACKNOWLEDGEMENT: The authors are grateful to the Principal Rev Dr. Fr. Praveen Martis SJ and the Management of St Aloysius College (Autonomous) Mangalore for providing necessary lab facilities. We acknowledge VGST- RFTT for providing the research grant. We thank MJES SAC for supporting the work with an intramural research grant. Ms. Vijayalakshmi Gangadhara thanks Rev Dr. Fr Leo D’Souza, SJ and Bartena Foundation for the research fellowship.
CONFLICTS OF INTEREST: There is no conflict of interest.
REFERENCES:
- Ali DC, Naveed M, Gordon A, Majeed F, Saeed M, Ogbuke MI, Atif M, Zubair HM and Changxing L: β-Adrenergic receptor, an essential target in cardiovascular diseases. Heart Failure Reviews 2020; 25(2): 343-54.
- Gacasan SB, Baker DL and Parrill AL: G protein-coupled receptors: the evolution of structural insight. AIMS Biophysics 2017; 4(3): 491
- Okeke K, Angers S, Bouvier M and Michel MC: Agonist‐induced desensitisation of β3‐adrenoceptors: Where, when, and how. British Journal of Pharmacology 2019; 176(14): 2539-58.
- Wu Y, Zeng L and Zhao S: Ligands of adrenergic receptors: a structural point of view. Biomolecules 2021; 11(7): 936.
- Hostrup M and Onslev J: The beta2‐adrenergic receptor–a re‐emerging target to combat obesity and induce leanness. The Journal of Physiology 2022; 600(5): 1209-27.
- Bubb KJ, Ravindran D, Cartland SP, Finemore M, Clayton ZE, Tsang M, Tang O, Kavurma MM, Patel S and Figtree GA: β 3 Adrenergic Receptor Stimulation Promotes Reperfusion in Ischemic Limbs in a Murine Diabetic Model. Frontiers in Pharmacology 2021; 12: 666334.
- Valentine JM, Ahmadian M, Keinan O, Abu-Odeh M, Zhao P, Zhou X, Keller MP, Gao H, Ruth TY, Liddle C and Downes M: β3-adrenergic receptor downregulation leads to adipocyte catecholamine resistance in obesity. The Journal of Clinical Investigation 2022; 132(2).
- Shi Y, Pizzini J, Wang H, Das F, Azees PA, Choudhury GG, Barnes JL, Zang M, Weintraub ST, Yeh CK and Katz MS. GPCRs -Mediated Regulation of Fuel and Energy Metabolism in Peripheral Tissues: β2-Adrenergic receptor agonist induced hepatic steatosis in mice: modelingnonalcoholic fatty liver disease in hyperadrenergic states. American Journal of Physiology-Endocrinology and Metabolism 2021; 321(1): 90.
- Ginzinger DG. Gene quantification using real-time Quantitative PCR: an emerging technology hits the mainstream. Exper Hematology 2002; 30(6): 503-12.
- Thornton B and Basu C. Real‐time PCR (qPCR) primer design using free online software. Biochemistry and Molecular Biology Education 2011; 39(2): 145-54.
- Pauthenier C and Faulon JL: Precise Primer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling. Nucleic Acids Research 2014; 42(1): 205-942.
- Chen KH, Longley R, Bonito G and Liao HL: A two-step PCR protocol enabling flexible primer choice and high sequencing yield for Illumina MiSeq meta-barcoding. Agronomy 2021; 11(7): 1274.
- Delghandi M, Delghandi MP and Goddard S: The significance of PCR primer design in genetic diversity studies: exemplified by recent research into the genetic structure of marine species. PCR Primer Design 2022; 3-15.
- Kumar A and Chordia N: In-silico PCR primer designing and validation. In PCR primer design Humana Press, New York, NY 2015; 143-151.
- Madeira F, Park YM, Lee J, Buso N, Gur T, Madhusoodanan N, Basutkar P, Tivey AR, Potter SC, Finn RD and Lopez R: The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Research 2019; 47(1): 636-41.
- Kalendar R, Shustov AV, Seppänen MM, Schulman AH and Stoddard FL: Palindromic sequence-targeted (PST) PCR: a rapid and efficient method for high-throughput gene characterization and genome walking. Scientific Reports 2019; 9(1): 1-1.
- Wrobel G, Kokocinski F and Lichter P: AutoPrime: selecting primers for expressed sequences. Genome Biology 2004; 5(5): 1-8.
- Abd-Elsalam KA: Bioinformatic tools and guideline for PCR primer design. african Journal of Biotechnology 2003; 2(5): 91-5.
- Kalendar R, Khassenov B, Ramankulov Y, Samuilova O and Ivanov KI: FastPCR: An in-silico tool for fast primer and probe design and advanced sequence analysis. Genomics 2017; 109(3-4): 312-9.
- Guo J, Starr D, Guo H. Classification and review of free PCR primer design software. Bioinformatics 2020; 36(22-23): 5263-8.
- Kalendar R, Muterko A, Shamekova M and Zhambakin K: In-silico PCR tools for a fast primer, probe, and advanced searching. InPCR 2017; Springer, New York NY 1-31.
- Korf I and Gish W: MPBLAST: improved BLAST performance with multiplexed queries. Bioinformatics. 2000; 16(11): 1052-3.
- Vallone PM and Butler JM: AutoDimer: a screening tool for primer-dimer and hairpin structures. Biotechniques. 2004; 37(2): 226-31.
- Kumar S, Stecher G, Li M, Knyaz C and Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and EEvolution 2018; 35(6): 1547.
- Arvidsson S, Kwasniewski M, Riaño-Pachón DM and Mueller-Roeber B: QuantPrime–a flexible tool for reliable high-throughput primer design for quantitative PCR. BMC Bioinformatics 2008 9(1): 1-5.
How to cite this article:
Abraham VGA: Primer designing and standardization of primer annealing temperature for beta-3-adrenergic receptor in Mus musculus. Int J Pharm Sci & Res 2023; 14(4): 1934-39. doi: 10.13040/IJPSR.0975-8232.14(4).1934-39.
All © 2023 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
42
1934-1939
731 KB
1758
English
IJPSR
Vijayalakshmi Gangadhara and Asha Abraham *
Department of Post Graduate Studies & Research in Biotechnology, St Aloysius College (Autonomous) - Affiliated to Mangalore University, Mangalore, Karnataka, India.
drashaabraham@staloysius.edu.in
17 August 2022
13 October 2022
31 October 2022
10.13040/IJPSR.0975-8232.14(4).1934-39
01 April 2023








