THE TREATMENT OF TRAMADOL WITH CREAM CONTAINING 3.33% DOXEPIN AND 0.05% CAPSAICIN ON THE OVERALL IMPROVEMENT OF QUALITY OF LIFE IN POST HERPETIC NEURALGIA PATIENTS
HTML Full TextTHE TREATMENT OF TRAMADOL WITH CREAM CONTAINING 3.33% DOXEPIN AND 0.05% CAPSAICIN ON THE OVERALL IMPROVEMENT OF QUALITY OF LIFE IN POST HERPETIC NEURALGIA PATIENTS
Namita Vilas Nasare 1, 2*, Pramod Kumari Mediratta 1, Basu Dev Banerjee 2 , Pravin Suryakantrao Deshmukh 2 , Ashok Kumar Saxena 3, Sambit Nath Bhattacharya 4 and Rafat S Ahmed 2
Department of Pharmacology 1, Environmental Biochemistry and Molecular Biology Laboratory, Department of Biochemistry 2, Department of Anesthesia 3, University College of Medical Sciences & G.T.B. Hospital, Delhi – 110095, India
Department of Dermatology and Venerology 4, University College of Medical Sciences, (University of Delhi) and GTB Hospital, Dilshad Garden, New Delhi-110095, India
ABSTRACT: The main purpose of the study was to examine the effect of QoL of PHN patients after the treatment of tramadol (50mg-200mg), with topical cream containing 3.33% doxepin and 0.05% capsaicin and clinical correlations with CYP2D6 polymorphism. The study was prospective, non-responders versus responders, conducted in 246 outpatients of PHN undergoing tramadol treatment for 4 weeks. Rescue analgesia given in the form of the topical cream consisting of the combination of 3.33% doxepin and 0.05% capsaicin to the affected areas of patients along with tramadol therapy. The QoL as per WHO QoL BREF Questionnaire was evaluated in all the study participants. All samples were analyzed for CYP2D6 (*2,*4 and *10) polymorphism using PCR-RFLP method. Although the QoL score showed magnitude of improvement was higher in responders as compared to non-responders. Insignificant interactions were found in all domains of QoL with respect to CYP2D6*2 and CYP2D6*4 polymorphism. However, a significant (p<0.001) interaction was found in CYP2D6*10 polymorphism with respect to environmental domain of QoL. A significant interaction was found with CYP2D6*10 allele with respect to environmental domain of QoL whereas lack of an association was found between CYP2D6*2 and *4 polymorphisms with QoL in PHN patients.
| Keywords: |
Quality of life,
Post herpetic neuralgia,
CYP2D6 polymorphism,
Tramadol, Doxepin, Capsaicin
INTRODUCTION: Postherpetic neuralgia (PHN) a sequel of acute herpes zoster, may be associated with severe pain and sensory abnormalities that adversely affect a patient’s QOL 1. The effects of neuropathic pain on WHO QOLBREF are well known 2 and although clinical intuition would suggest that reducing neuropathic pain would improve these broader indices of well-being 3.
Current evidence indicates that pain reduction is not always accompanied by the improvement in domains of QOL 4-6. Such discrepancies could be explained by adverse treatment effects and/or concurrent chronic illness. The herpes zostar (HZ) and PHN can have a devastating effect on QOL, affecting physical, functional, psychological and social domains 7-14. Patients have reduced functional ability, with many becoming inactive or housebound. QOL seems to be a particular problem in patients whose pain persists as PHN 8-10, 15-17. Opioids such as tramadol are receiving greater consideration for the treatment of PHN type of pain 18-21. Tramadol is a weak μ -opioid agonist that inhibits the reuptake of norepinephrine and serotonin.
The results of randomized control trials in patients with PHN, painful DPN, painful polyneuropathies, PHN of different etiologies, and postamputation pain demonstrated that tramadol reduced pain and improved some aspects of health-related quality of life 18-20, 22-25. But it has developed lots of drug-induced adverse side-effects such as somnolence, dizziness, local site reaction, headache, hypotension, nausea and vomiting 20, 26-30. Tramadol is metabolized by the CYP2D6 enzyme 31, 20, 21. The CYP2D6 polymorphism has been reported to significantly affect the pharmacokinetics of tramadol 32. The variation in CYP2D6 activity may impact upon a patients pain level and may contribute to interindividual variation in their response to opioids 33,34,20,21. This enzyme plays a vital role in deciding doses of tramadol in PHN patients.
Currently, in the Indian scenario, few studies has been published to establish the clinical utility of CYP2D6 genotyping determining in relation to tramadol therapy with respect to QOL. The present study was designed to impact on QOL treated with oral tramadol (50mg-200mg) and topical application of a cream consisting of the combination of 3.33% doxepin and 0.05% capsaicin. In addition, the relationship between the clinical efficacy of QOL and CYP2D6 (*2, *4 and *10) polymorphism in PHN patients repeated administration for 4 weeks between non- responders and responders.
MATERIAL AND METHODS:
Study design:
The study was a prospective, non-responders versus responders in the treatment of PHN and consisted of oral administration of tramadol (short acting) for 4 weeks with day 0 (baseline) considered as a baseline. A total of 270 patients were initially enrolled for the treatment of which 15 patients did not fit the inclusion criteria and 9 patients did not receive tramadol therapy, according to the study design. This prospective study included 246 patients (age group 20-80 years) of PHN patients reported with less than 50% pain relief were categorized as “non- responders” (72 males and 51 females), and patients reported with 50% pain relief with 14 days of tramadol were categorized as “responders” (76 males, and 47 females).
The present study was carried out with the help of pain clinic, Department of Anesthesiology, Department of Dermatology and all molecular biology analysis were carried out in Environmental Biochemistry and Molecular Biology Laboratory, Department of Biochemistry and Department of Pharmacology at University College of Medical Sciences (University of Delhi) & Guru Teg Bahadur Hospital, New Delhi- 110095, India during the period January 2009 to January 2012. Prior approval of Institutional Ethics Committee –Human Research was received and patients consent was taken in written in the printed Performa.
In our previous published papers have already discussed duration of oral tramadol treatment were 4 weeks from day 0 (inclusion visit) to day 28 (the day before the end visit), dose incrementation, inclusion criteria and exlusion criteria 19-21. All the patients in group non-responders and responders who were not satisfied with recommended tramadol therapy, were provided rescue analgesia, which consisted of a cream containing 3.33% doxepin (a long acting tricyclic) and 0.05% capsaicin applied topically four times a day to affected areas continuously for 4 weeks. A record of pain management with rescue analgesia cream was maintained in the case record form of each patient.
Quality of Life (QOL) Scores:
The Quality of life of PHN patients was studied using WHO QOL-BREF questionnaire which consisted of four domains: Domain 1 (physical health); domain 2 (psychological health); domain 3 (social relationships); and domain 4 (environmental health). The above mentioned measurements were recorded on scheduled visits: inclusion visit on day 0, follow-up visits on day 14 and end visit on day 28 35.
Genotyping:
5 ml of blood was taken out from each patient and collected in EDTA coated vials. DNA was extracted using commercially available DNA extraction kit (Hi- Media Mini preparation kit, Hi- Media Laboratories Pvt. Ltd. Mumbai, India). The PCR-RFLP was done by digesting PCR product with their respective restriction enzyme that determines the polymorphic site depending on the presence or absence of its recognition sequence (Table 1). The UM, EM, IM and PM patients were categorized based on genetic analysis (PCR-RFLP Method) 20, 21, 36, 37.
TABLE 1: PRIMER SEQUENCES AND PCR-RFLP DETECTION METHOD USING THEIR RESPECTIVE ENZYMES
| Sr. No. | Assay | Primer Sequences | Detection Method | |
| 1 | *2 | 5’GCTGGGGCCTGAGACTT’35’GGCTATCACCAGGTGCTGGTGCT3’ | PCR-RFLPusing Hhal | |
| 2 | *4 | 5’ TGCCGCCTTCGCCAACCACT3’5’TCGCCCTGCAGAGACTCCTC3’ | PCR-RFLPusing BstNI | |
| 3 | *10 | 5’GTGCTGAGAGTGTCCTGCC3’5’ CACCCACCATCCATGTTTGC3’ | PCR-RFLPusing HphI | |
TABLE 2: MEAN WHOBREF –QOL SCORES AT VARIOUS TIME INTERVALS AMONG NON-RESPONDERS AND RESPONDERS WITH GENDERS
| QoL Domains | Groups | Genders | Baseline | Second week | Forth week | ||
| p-value | p- value | ||||||
| Sociological
Domain |
NR(n=123) | Male(n=72) | 49.22±5.444 | 56.71±9.132 | p<0.001 | 60.04±9.890 | p<0.001 |
| Female (n=51) | 46.96±5.506 | 55.67±9.232 | 58.80±9.942 | ||||
| p-value | p=0.026 | p=0.537 | p=0.497 | ||||
| R(n=123) | Male(n=77) | 57.29±6.565 | 64.22±6.445 | 72.12±7.397 | |||
| Female (n=46) | 56.20±6.510 | 63.63±6.939 | 72.22±7.823 | ||||
| p-value | p=0.425 | p=0.715 | p=0.857 | ||||
| Physiological
Domain |
NR(n=123) | Male(n=72) | 41.89±5.264 | 49.14±8.345 | p=0.625 | 52.51±10.578 | p<0.001 |
| Female (n=51) | 41.25±5.713 | 48.37±9.099 | 50.39±9.733 | ||||
| p-value | p=0.533 | p=0.635 | p=0.253 | ||||
| R(n=123) | Male(n=77) | 44.32±6.847 | 50.01±6.713 | 56.09±7.068 | |||
| Female (n=46) | 42.26±5.230 | 48.09±5.391 | 54.74±5.717 | ||||
| p-value | p=0.071 | p=0.106 | p=0.288 | ||||
| Psychological
Domain |
NR(n=123) | Male(n=72) | 44.61±5.266 | 52.31±8.735 | p<0.001 | 53.79±10.289 | p<0.001 |
| Female(n=51) | 43.88±5.512 | 51.00±8.514 | 53.41±10.306 | ||||
| p-value | p=0.464 | p=0.409 | p=0.841 | ||||
| R(n=123) | Male(n=77) | 51.17±6.590 | 57.27±6.227 | 63.94±6.804 | |||
| Female( n=46) | 49.39±6.323 | 56.02±5.998 | 63.67±6.922 | ||||
| p-value | p=0.169 | P=0.319 | P=0.904 | ||||
| Environmental
Domain |
NR(n=123) | Male(n=72) | 53.08±5.109 | 60.82±9.155 | p<0.001 | 64.68±8.968 | p<0.001 |
| Female (n=51) | 51.45±6.287 | 59.39±8.994 | 64.29±9.377 | ||||
| p-value | p=0.129 | p=0.391 | p=0.819 | ||||
| R(n=123) | Male(n=77) | 64.18±6.920 | 72.23±7.312 | 80.44±8.416 | |||
| Female (n=46) | 63.87±7.664 | 72.04±7.665 | 81.72±8.482 | ||||
| p -value | p=0.924 | p=0.965 | p=0.367 | ||||
N- Non-responders, R-responders; All values are expressed as numbers and mean ± standard deviation
Statistical analysis:
The unpaired t-test was used to compare all mean differences between the two groups on day 14. One-factor repeated measure analysis of variance (ANOVA) was used to compare the means within the group at different time intervals with Bonferroni adjustment (α=0.05) in both the groups separately. Analysis of covariance was used to compare QOL in responders and non-responders after adjusting for baseline values, age and sex. Fisher’s exact test was carried out, to find an association between sex and metabolizers.
Two-factor repeated measure ANOVA was used to compare QOL within, and among metabolizers with Bonferroni adjustment (α= 0.05) in both groups.Three factor repeated measure ANOVA was applied taking time as a repeated factor, group and metabolizer as a fix factor. We report multivariate (Wilks’ Lambda test) analysis since the Mauchly’s test of Sphericity was found to significant in all QOL variables.
RESULTS:
Patient data:
Both the groups (123 non- responders and 123 responders) of PHN patients were comparable with respect to age and gender ratio. The total gender means in non-responders were 53.33±12.47 (males 53.94±13.24; females 52.45±11.35) and total mean in responders were 52.23±12.08 (males 53.50±12.72; females 50.17±10.79.33). The mean age (in years) of patients in non-responders were 53.33±12.47 and in responders were 52.23±12.08. The mean weight (in kg) in group, non-responders were 56.28±10.95 and in responders were 51.23±11.45. The mean duration of disease (in months) of patients in non-responders were 4.79±3.48 and in responders were 4.23±4.47. The gender ratio (Male: Female) in non-responders and responders were 72:51 and 76:47 respectively.
WHO QOL BREF Scores Clinically:
In the four domains of quality of life, there was no statistical difference in the groups at baseline (p>0.05). There was a significant improvement in all the domains of quality of life in responders as compared to non-responders at the end of 2nd week and 4th week of treatment after adjusting their baseline values (Figure 1).
WHOQOL BREF Scores with respect to Genders:
In all the four domains of QOL, there was no statistical significant difference in the genders at baseline, 2nd and 4th week (p>0.05). At the end of 2nd week, all domains except physiological domain was statistically significant between the groups (p<0.05). The improvement in all the domains of QOL was statistically significant in responders as compared to non-responders at the end of 4th week of treatment (Table 2).
WHO QOL BREF with respect to CYP2D6 Polymorphism:
In CYP2D6*2 allele, PMs in non-responders group were found higher in numbers than responders group whereas high numbers of EMs were found in responders than non-responders. Clinically overall there was significant (p<0.001) change observed in all domains of QOL. Three way repeated measure ANOVA was carried out to find out interactions between time, group and metabolize using Wilks’s Lambda for repeated measures analysis. No significant interaction was found in CYP2D6*2 allele in all domains of QOL.
In CYP2D6*4 allele, in non-responders no UMs was observed whereas in responders eight patients were found. Clinically, significant (p<0.001) improvement observed in all domains of QOL. The multivariate analysis with CYP2D6*4 allele showed no significant interaction in all domains of QOL.
In CYP2D6*10 allele, overall significant change in QOL scores was observed with respect to time (p<0.001) in all domains. Since the Mauchly’s Test of Sphericity was found to be significant, we report the multivariate test for repeated measures analysis. The multivariate analysis using Wilks’s Lambda test insignificant interaction was found between group and metabolizers (p=0.279) also among time, group and metabolizers (p=0.282) whereas significant interaction was found between time and group (p=0.010) in sociological domain. In psychological domain, we observed significant interaction with group (p=0.033) but in the physiological domain no interaction was found to be significant. Interaction between time, group and metabolizers (p=0.048) and between time and metabolizers (p<0.001) were found to be significant in environmental domain (Table 3-5).
TABLE 3: WHO-BREF (QoL) SCORES AND CYP2D6*2 POLYMORPHISM
| WHO-BREF(QoL) | Group | Metabolizers | Baseline | 2nd Week | 4th Week | P value |
| SociologicalDomain | NR | UM( n=4) | 48.50±9.037 | 47.00±6.976 | 61.50±12.369 | p=0.001ap=0.217b
p=0.805c p=0.448d |
| EM( n=56) | 48.95±5.913 | 57.46±9.177 | 60.16 ±10.160 | |||
| IM(n=30) | 47.30±5.402 | 56.53±8.500 | 58.20±10.226 | |||
| PM(n=33) | 48.03±4.687 | 55.15±9.477 | 59.42±9.138 | |||
| Total (n=123) | 48.28±5.561 | 56.28±9.150 | 59.53±9.890 | |||
| R | UM( n=3) | 63.67±8.963 | 71.00±9.644 | 76.33±8.505 | ||
| EM(n=65) | 56.95±6.138 | 64.06±6.324 | 72.09 ±7.414 | |||
| IM(n=41) | 56.66±6.829 | 63.49±6.896 | 72.32±7.738 | |||
| PM(n=14) | 55.71±6.911 | 63.71±6.366 | 71.07±7.770 | |||
| Total (n=123) | 56.88±6.539 | 64.00±6.612 | 72.15±7.527 | p=0.001ap=0.531b
p=0.932c p=0.968d |
||
| PhysiologicalDomain | NR | UM( n=4) | 42.50±10.247 | 44.75±11.673 | 52.50±10.599 | |
| EM( n=56) | 41.95±5.405 | 49.45±8.697 | 51.66±10.277 | |||
| IM(n=30) | 41.57±6.151 | 49.50±8.480 | 51.60±11.205 | |||
| PM(n=33) | 41.03±4.224 | 47.64±8.477 | 51.52±9.722 | |||
| Total (n=123) | 41.63±5.440 | 48.82±8.638 | 51.63±10.249 | |||
| R | UM( n=3) | 43.00±4.583 | 47.33±3.055 | 53.33±4.509 | ||
| EM(n=65) | 43.75±6.070 | 49.46±6.049 | 56.02±6.606 | |||
| IM(n=41) | 43.56±6.823 | 49.34±6.905 | 55.27±6.786 | |||
| PM(n=14) | 42.71±7.021 | 48.79±6.530 | 55.00±6.839 | |||
| Total (n=123) | 43.55±6.348 | 49.29±6.298 | 55.59±6.603 | |||
| PsychologicalDomain | NR | UM( n=4) | 44.75±10.046 | 44.50±6.856 | 55.50±10.630 | p=0.001ap=0.288b
p=0.843c p=0.592d |
| EM( n=56) | 44.61±5.287 | 52.32±8.458 | 54.21±10.350 | |||
| IM(n=30) | 43.90±5.671 | 52.80±8.930 | 52.97±11.059 | |||
| PM(n=33) | 44.12±4.742 | 50.76±8.678 | 53.03±9.681 | |||
| Total (n=123) | 44.31±5.359 | 51.76±8.633 | 53.63±10.255 | |||
| R | UM( n=3) | 53.00±5.568 | 59.33±3.215 | 63.00±2.646 | ||
| EM(n=65) | 50.77±6.446 | 56.78±5.920 | 63.78±6.800 | |||
| IM(n=41) | 50.27±6.793 | 56.83±6.752 | 64.20±7.184 | |||
| PM(n=14) | 49.43±6.688 | 56.29±6.207 | 63.21±6.941 | |||
| Total (n=123) | 50.50±6.523 | 56.80±6.148 | 63.84±6.821 | |||
| EnvironmentalDomain | NR | UM( n=4) | 52.75±7.41 | 54.00±7.394 | 65.25±8.694 | p=0.001ap=0.126b
p=0.722c p=0.709d |
| EM( n=56) | 53.20±6.07 | 60.71±9.376 | 65.48±8.737 | |||
| IM(n=30) | 52.17±5.93 | 61.17±8.346 | 63.23±10.251 | |||
| PM(n=33) | 51.24±4.37 | 59.30±9.376 | 63.97±8.883 | |||
| Total (n=123) | 52.41±5.66 | 60.23±9.079 | 64.52±9.104 | |||
| R | UM( n=3) | 74..33±12.70 | 81.00±8.660 | 87.67±7.234 | ||
| EM(n=65) | 63.98±6.88 | 72.12±7.116 | 81.29±8.591 | |||
| IM(n=41) | 63.85±7.04 | 71.61±7.733 | 80.54±8.491 | |||
| PM(n=14) | 62.86±6.84 | 72.07±7.227 | 78.86±7.564 | |||
| Total (n=123) | 64.07±7.17 | 72.16±7.416 | 80.92±8.429 |
All values are expressed in means and standard deviation; EM- Extensive metabolizers; IM- Intermediate Metabolizers; PM- Poor metabolizers; NR- non-responders and R-responders; a-interaction with time; b-interaction with group (non-responders versus responders); c- interaction with metabolizers and group; d- interaction with group (non-responders versus responders), metabolizers and time; Analysis was performed by Three Way Repeated measure ANOVA using Wilks’s Lambda test.
DISCUSSION: In the management of PHN, there is no better therapy or intervention approach. With most forms of neuropathic pain, the treatment response is best described as inconsistent. The chronic neuropathic pain present in the patients of PHN is mainly due to peripheral and central sensitization 38, 39. The primary aim of this study was to find tramadol (50-200mg) with a topical cream containing 3.33% doxepin and 0.05% capsaicin administered over 4 weeks in patients suffering from PHN was improved on quality of life domains. The secondary aim of this study was clinically efficacy of QOL relationship with CYP2D6 *2, *4 and *10 polymorphism. The adoption of the single entity therapy approach in the present study results significantly improvement quality of life which was evidenced by the significant (p<0.001) increase in scores of physical, psychological, social relationships, and environmental domains of WHO QOL BREF questionnaire in post herpetic neuralgia patients.
However, no statistical difference was found between responders and non-responders at baseline and gender wise no association was observed with all QOL domains. It also confirmed that the previous preliminary work reported orally administered tramadol (50–200 mg) over 4 weeks is safe and improved quality of life in PHN patients (32 non responders and 68 responders) 19.
TABLE 4: WHO-BREF (QoL) SCORES AND CYP2D6*4 POLYMORPHISM
| WHO-BREF( QoL ) | Group | Metabolizers | Baseline | 2nd Week | 4th Week | P value |
| SociologicalDomain | NR | UM( n=0) | - | - | - | p=0.001ap=0.202b
p=0.966c p=0.313d |
| EM( n=77) | 47.71±5.753 | 56.82±8.874 | 59.51±10.178 | |||
| IM(n=34) | 49.97±4.758 | 57.15±8.982 | 59.76±9.863 | |||
| PM(n=12) | 46.00±4.405 | 48.73±8.684 | 57.82±8.122 | |||
| Total (n=123) | 48.19±5.481 | 56.18±9.125 | 59.43±9.865 | |||
| R | UM( n=8) | 55.38±5.290 | 63.62±3.926 | 72.38±6.567 | ||
| EM(n=92) | 56.86±6.791 | 63.75±6.931 | 71.63±7.987 | |||
| IM(n=21) | 57.95±5.844 | 65.57±6.046 | 74.90±5.078 | |||
| PM(n=2) | 52.50±7.778 | 60.50±6.364 | 66.50±6.364 | |||
| Total (n=123) | 56.88±6.539 | 64.00±6.612 | 72.15±7.527 | p=0.001ap=0.335b
p=0.666c p=0.143d |
||
| PhysiologicalDomain | NR | UM( n=0) | - | - | - | |
| EM( n=77) | 41.08±5.370 | 49.49±8.570 | 52.05±10.222 | |||
| IM(n=34) | 42.88±5.912 | 50.06±7.707 | 50.97±10.556 | |||
| PM(n=12) | 41.55±4.344 | 40.18±8.072 | 50.00±10.334 | |||
| Total (n=123) | 41.62±5.463 | 48.81±8.672 | 51.57±10.263 | |||
| R | UM( n=8) | 40.00±5.451 | 46.12±4.454 | 53.5±05.071 | ||
| EM(n=92) | 43.99±6.133 | 49.58±6.245 | 55.5±36.734 | |||
| IM(n=21) | 43.38±7.145 | 49.57±7.040 | 56.9±06.700 | |||
| PM(n=2) | 39.501±0.607 | 46.00±7.071 | 52.50±4.950 | |||
| Total (n=123) | 43.55±6.348 | 49.29±6.298 | 55.59±6.603 | |||
| PsychologicalDomain | NR | UM( n=0) | - | - | - | p=0.001ap=0.137b
p=0.917c p=0.351d |
| EM( n=77) | 43.62±4.894 | 52.19±8.505 | 53.56±10.323 | |||
| IM(n=34) | 45.71±6.023 | 52.68±8.171 | 53.91±10.743 | |||
| PM(n=12) | 43.55±4.367 | 44.82±8.171 | 52.00±8.270 | |||
| Total (n=123) | 44.20±5.234 | 51.66±8.596 | 53.52±10.214 | |||
| R | UM( n=8) | 47.50±4.811 | 53.62±4.689 | 61.75±5.574 | ||
| EM(n=92) | 50.75±6.609 | 56.96±6.154 | 63.61±7.007 | |||
| IM(n=21) | 51.00±6.550 | 57.62±6.515 | 66.056.273 | |||
| PM(n=2) | 46.00±8.485 | 54.00±7.071 | 59.50±4.950 | |||
| Total (n=123) | 50.50±6.523 | 56.80±6.148 | 63.84±6.821 | |||
| EnvironmentalDomain | NR | UM( n=0) | - | - | - | p=0.001ap=0.086b
p=0.890c p=0.335d |
| EM( n=77) | 51.96±5.818 | 60.65±8.596 | 64.64±8.887 | |||
| IM(n=34) | 54.03±5.208 | 61.18±9.498 | 64.26±10.264 | |||
| PM(n=12) | 49.82±4.535 | 53.45±9.048 | 63.45±6.962 | |||
| Total (n=123) | 52.34±5.642 | 60.15±9.072 | 64.43±9.081 | |||
| R | UM( n=8) | 63.88±5.693 | 72.88±6.512 | 83.88±7.453 | ||
| EM(n=92) | 63.66±7.520 | 71.54±7.781 | 79.87±8.882 | |||
| IM(n=21) | 66.33±6.011 | 75.00±5.666 | 84.81±5.056 | |||
| PM(n=2) | 59.50±4.950 | 68.00±4.243 | 76.50±7.778 | |||
| Total (n=123) | 64.07±7.178 | 72.16±7.416 | 80.92±8.429 |
All values are expressed in means and standard deviation; EM- Extensive metabolizers; IM- Intermediate Metabolizers; PM- Poor metabolizers; NR- non-responders and R-responders; a-interaction with time; b-interaction with group (non-responders versus responders); c- interaction with metabolizers and group; d- interaction with group (non-responders versus responders), metabolizers and time; Analysis was performed by Three Way Repeated measure ANOVA using Wilks’s Lambda test.
TABLE 5: WHO-BREF (QoL) and CYP2D6*10 POLYMORPHISM
| WHO-BREF(QoL) | Group | Metabolizers | Baseline | 2nd Week | 4th Week | P value |
| SociologicalDomain | NR | EM( n=81) | 52.68±5.935 | 55.75±9.481 | 59.06±10.053 | p=0.001ap=0.010b
p=0.279c p=0.282d |
| IM(n=30) | 51.90±4.664 | 58.50±8.170 | 62.13±9.126 | |||
| PM(n=12) | 51.83±6.351 | 54.25±8.884 | 56.17±9.889 | |||
| Total (n=123) | 52.41±5.661 | 56.28±9.150 | 59.53±9.890 | |||
| R | EM(n=88) | 64.44±7.606 | 64.40±6.669 | 72.26±7.672 | ||
| IM(n=30) | 63.57±6.235 | 63.33±6.890 | 72.17±7.702 | |||
| PM(n=5) | 60.40±3.050 | 61.00±2.000 | 70.20±3.564 | |||
| Total (n=123) | 64.07±7.178 | 64.00±6.612 | 72.15±7.527 | p=0.001ap=0.033b
p=0.351c p=0.168d |
||
| PsychologicalDomain | NR | EM( n=81) | 44.74±5.698 | 51.42±8.913 | 52.78±10.705 | |
| IM(n=30) | 43.10±3.595 | 53.23±7.815 | 56.47±8.737 | |||
| PM(n=12) | 44.42±6.557 | 50.42±8.888 | 52.33±10.129 | |||
| Total (n=123) | 44.31±5.359 | 51.76±8.633 | 53.63±10.255 | |||
| R | EM(n=88) | 50.86±6.601 | 57.23±6.346 | 64.19±7.043 | ||
| IM(n=30) | 50.20±6.467 | 56.13±5.835 | 63.30±6.603 | |||
| PM(n=5) | 46.00±4.243 | 53.40±2.881 | 60.80±2.775 | |||
| Total (n=123) | 50.50±6.523 | 56.80±6.148 | 63.84±6.821 | |||
| PhysiologicalDomain | NR | UM( n=) | - | - | - |
p=0.001a p=0.166b p=0.304c p=0.228d |
| EM( n=81) | 42.02±5.552 | 48.48±8.850 | 50.44±10.320 | |||
| IM(n=30) | 40.87±4.158 | 49.90±8.130 | 55.00±9.541 | |||
| PM(n=12) | 40.83±7.420 | 48.42±8.908 | 51.25±10.437 | |||
| Total (n=123) | 41.63±5.440 | 48.82±8.638 | 51.63±10.249 | |||
| R | EM(n=88) | 43.97±6.396 | 49.81±6.409 | 56.00±6.638 | ||
| IM(n=30) | 43.13±6.235 | 48.53±6.078 | 55.00±6.843 | |||
| PM(n=5) | 38.80±4.919 | 44.80±3.633 | 51.80±2.775 | |||
| Total (n=123) | 43.55±6.348 | 49.29±6.298 | 55.59±6.603 | |||
| EnvironmentalDomain | NR | EM( n=81) | 52.68±5.935 | 59.52±9.553 | 64.30±9.302 | p=0.001ap=0.001b
p=0.378c p=0.048d |
| IM(n=30) | 51.90±4.664 | 63.03±7.425 | 66.83±7.349 | |||
| PM(n=12) | 51.83±6.351 | 58.00±8.634 | 60.25±10.610 | |||
| Total (n=123) | 52.41±5.661 | 60.23±9.079 | 64.52±9.104 | |||
| R | EM(n=88) | 64.44±7.606 | 72.61±7.677 | 81.07±8.627 | ||
| IM(n=30) | 63.57±6.235 | 71.27±7.172 | 80.30±8.384 | |||
| PM(n=5) | 60.40±3.050 | 69.60±1.949 | 82.00±5.788 | |||
| Total (n=123) | 58.24±8.702 | 72.16±7.416 | 80.92±8.429 |
All values are expressed in means and standard deviation; EM- Extensive metabolizers; IM- Intermediate Metabolizers; PM- Poor metabolizers; NR- non-responders and R-responders;a-interaction with time;b-interaction with group (non-responders versus responders);c- interaction with metabolizers and group;d- interaction with group (non-responders versus responders), metabolizers and time;Analysis was performed by Three Way Repeated measure ANOVA using Wilks’s Lambda test.
In addition, WHO QOL-BREF scores showed no significant (P > 0.05) difference was observed in all 4 domains of QOL in non responders and responders at day 0( baseline). Moreover, a significant (P < 0.001) improvement was observed in QOL scores in all 4 domains after weeks 2nd and 4th in both groups with respect to their respective baseline values only. A significant difference was observed between non responders and responders at days 14 and 28 in only 2 domains (ie, social and physical domains) 20, 21.
The single-entity therapy medications have consistently improved QOL of subjects. In the patients with PHN, the opioids 13, 40, 5 have all produced statistically significant improvements in QOL relative to placebo. Hence this study confirms that orally administered tramadol over 4 weeks is safe in PHN patients.
Two open-label, nonrandomized, prospective studies 41, 42 showed that the lidocaine patch 5% (applied over the area of maximal pain) reduced the intensity of moderate-to-severe PHN pain and improved quality of life 41.
The treatment of NP (neuropathic pain) is challenging and compared with non neuropathic chronic pain patients. Patients with NP seem to have higher average pain scores and lower HRQOL (even after adjusting for pain scores); to require more medications; and to report less pain relief with treatment 43, 44. The neuropathic pain has been shown to impair patients’ overall health-related QOL, including important aspects of physical and emotional functioning such as mobility and ability to work 8, 45, 46, 47, 48. It also generates substantial costs to society 48-51. Albert et al. 39 observed that the QOL of PHN patients is affected not only because of the excruciating pain, but also because of the indirect effect of chronic fatigue, compromised mobility, and diminished social networking. Patients with PHN report difficulty in concentrating.
FIG.1: WHO QUALITY OF LIFE- BRIEF QUESTION ARE SCORES IN FOUR DIFFERENT DOMAINS AT DIFFERENT TIME INTERVALS AMONG NONRESPONDERS AND RESPONDERS
They also fear recurrences of PHN symptoms and may experience changes in their emotional roles within key relationship. Patients experienced average pain of moderate intensity most of the time. Psycho-social variables such as measures of role functioning, personality disorder symptoms and disease conviction may be additional risk factors for PHN 13. This chronic complication remains refractory to pharmacological treatments and prevention strategies 53. PHN causes a loss of physical function, with patients experiencing fatigue, anorexia, weight loss, reduced mobility, physical inactivity, sleep disturbance and reductions in overall health 8, 15. It may also affect patients psychological well being 8.
The psychosocial scores improve in patients who fully recover from the acute symptoms of HZ, but they remain low in patients who develop PHN 54. The results of a postal survey in the USA used pain and QOL questionnaire, as showing that patients commonly reported moderate and severe levels of pain despite receiving analgesic agents 8. The increased awareness of the burden of HZ and PHN on QOL may lead to improve strategies for prevention and management. The goal of second objective was to provide data about the impact of differences in genetically polymorphic metabolic patterns of the CYP2D6 system and their role and relationship on QOL 4 week tramadol treated PHN patients.
In this study, QOL as per the WHO QOL BREF questionnaire was evaluated in all the study participants comparison with CYP2D6 polymorphism. The QOL status of PHN patients was not significantly associated with time, metabolizers and group. Insignificant interactions were found in all domains of QOL with respect to CYP2D6*2 and CYP2D6*4 alleles. However, a significant (p<0.001) interaction was found in CYP2D6*10 allele with respect to time, group and metabolizers in environmental domain of QOL.
To our knowledge, based on the genetic model of the CYP2D6 polymorphism, in present literature, it is hard to find QOL correlating with CYP2D6 genotypes of PHN patients.
In our previous study 20 reported relationship between the CYP2D6*4 polymorphism, interindividual differences in CYP2D6 activity and QOL in PHN patients receiving tramadol. The QOL scores obtained from 158 patients (78 non responders and 80 responders) who were treated with tramadol. In addition, the psychological, sociological and environmental domains demonstrated a significant (p < 0.05) association compared with the CYP2D6*4 allele using two-factor repeated measure analysis ANOVA. There was no association found between the physiological domain and the CYP2D6*4 allele (p > 0.05).
The impact of the CYP2D6 genotypes and phenotypes on tramadol pharmacokinetics among acute pain patients were reported by Gan et al 29. However, genotyping for CYP2D6*10 alone is not sufficient to explain tramadol disposition. When larger number of malysian patients were recruited (n=138), Gan et al29 found that relationship with pharmacokinetic-pharmacodynamic of tramadol.
They observed that high frequency of the CYP2D6*10 allele found Malaysian patients. The UM and EM groups had 2.6- and 1.3-times faster CL, respectively, than the IM. CL was 16, 18, 23, and 42 L/h while mean half-lives were 7.1, 6.8, 5.6, and 3.8 hours among the IM, EM1, EM2, and UM groups, respectively. However, the analgesic effects of tramadol were not measured adequately among the postoperative patients to establish its full therapeutic effects. There were significant differences in the adverse-effect profiles amongst the various genotype groups with the IMs group experiencing more adverse effects than the EMs and the EMs having more adverse effects than the UMs.
Three studies reported the impact of the CYP2D6 genotypes and phenotypes on tramadol analgesia among acute pain patients 55-57. Stamer et al 55 investigated whether the CYP2D6 genotype influenced the post-operative analgesia of tramadol (via IV bolus 100mg), PCA (combination of tramadol 20 mg/ml, dipyrone 200mg/ml and metoclopramide 0.4 mg/ml) and continuous infusion). They compared the pain scores analgesic consumption and need for resuce medication between heterozygous EMs and PMs. The hypothesis of reduced analgesic efficacy of tramadol in PMs was confirmed where they found that a well characterized group of PMs differed significantly in their response compared with the large group of patients carried at least one wild type of allele.
The perecentage of non responders was significantly higher in the PM (46.7%) compared with the EM (21.6%). Wang et al 56 found that the CYP2D6*10 allele has significant impact on analgesia with tramadol (10 mg/ml tramadol plus 0.3 mg/ml metoclopramide combination) via patient –controlled analgesia (PCA) in a Chinese population. Slanar et al 57 evaluated tramadol efficacy in relation to CYP2D6 and MDRI polymorphism. Tramadol was given on demand intramuscularly at a dosage of 100mg for one application or orally 50 mg in immediate relase formulation.
They found that the mean pain difference was lowest in the UM and highest in the PM. The pain difference varied significantly among the CYP2D6 subgroups with significant difference between homEMvs hetEM, hom EMvs. PM, and UMvs. PM subgroups. Finally they concluded that CYP2D6 plays a significant role in tramadol analgesic efficacy.
Zalina and Ismail 58, reviewed of the literature was the evidence on how CYP2D6 polymorphisms might influence pain sensititvity and clinical response to codaine and tramadol. Codaine and tramadol that are bioactivated by CYP2D6, PMs may cause no metabolite formation and lead to inadequate analgesia. Conversely, UMs may experience quicker analgesic effects but be prone to higher mu-opioid related toxicity. The literature suggested the potential uselfulness of the determination of CYP2D6 polymorphisms in elucidating serious adverse events and in preventing subsequent inappropriate selection or doses of codeine and tramadol.
CONCLUSION: Tramadol (50mg -200mg) with topical application of a cream consisting of the combination of 3.33% doxepin and 0.05% capsaicin treated PHN patients experienced maximum pain relief and improved quality of life in PHN patients. The CYP2D6*2 and *4 polymorphism may not be a predictor of treatment outcome of patients with QOL of PHN receiving tramadol.
ACKNOWLEDGMENT: The authors thank patients and their relatives for their support and cooperation. This study was supported by an SRF Fellowship grant (ICMR) provided to Mrs. Namita Vilas Nasare. Grant No. 45/22/09/ PHA-BMS.
REFERENCES:
- Cunningham AL and Dworkin RH: The management of post-herpetic neuralgia. BMJ 2000; 321(7264):778-779.
- Russell IJ, Kamin M and Sager DS: Efficacy of tramadolin treatment of pain in fibromyalgia. Arth Rheum 40(suppl);1997 : S52
- Drake LA and Millikan LE: The antipruritic effect of 5% doxepin cream in patients with eczematous dermatitis. Doxepin Study Group. Arch Dermatol 1995; 131(12):1403– 1408.
- Kost RG and Straus SE: Postherpetic neuralgia—pathogenesis, treatment, and prevention. NEJM 1996; 335(1):32–42.
- Kishore-Kumar R, Max MB, Schafer SC, Gaughan AM, Smoller B, Gracely RH and Dubner R: Desipramine relieves postherpetic neuralgia. Clin Pharmacol Ther 1990; 47(3):305-312.
- Watson CP, Tyler KL, Bickers DR, Millikan LE, Smith S and Coleman E: A randomized vehicle-controlled trial of topical capsaicin in the treatment of post herpetic neuralgia. Clin Ther 1993; 15:510–525.
- Schmader K: Herpes zoster in older adults. Clin Infect Dis 2001; 32(10):1481-1486.
- Oster G, Harding G, Dukes E, Edelsberg J and Cleary PD: Pain, medication use,and health-related quality of life in older persons with postherpetic neuralgia: results from a population-based survey. The journal of Pain 2005; 6(6): 356-363.
- Coplan PM, Schmader K, Nikas A, Chan IS, Choo P, Levin MJ, Johnson G, Bauer M, Williams HM, Kaplan KM, Guess HA, Oxman MN: Development of a measure of the burden of pain due to HZ and postherpetic neuralgia for prevention trials: Adaptation of the Brief Pain Inventory. J Pain 2004; 5: 344–356.
- Seventer van R, Sadosky A, Lucero M and Dukes E: A cross-sectional survey of health state impairment and treatment patterns in patients with postherpetic neuralgia. Age Ageing 2006; 35:132-137.
- Schmader KE, Sloane R, Pieper C, Coplan PM, Nikas A, Saddier P, Chan IS, Choo P, Levin MJ, Johnson G, Williams HM, Oxman MN: The impact of acute herpes zoster pain and discomfort on functional status and quality of life in older adults. Clin J Pain 2007; 23:490-496.
- Lydick E, Epstein RS, Himmelberger D and White CJ: Herpes zoster and quality of life: a self-limited disease with severe impact. Neurology 1995; 45(12Suppl 8):S52-S53.
- Katz J, Cooper EM, Walther RR, Sweeney EW, Dworkin RH : Acute pain in herpes zoster and its impact on health-related quality of life. Clinical Infectious Diseases 2004; 39(3):342-348.
- Brisson M, Pellissier JM, Camden S, Quach C, De Wals P: The potential cost-effectiveness of vaccination against herpes zosterand post-herpetic neuralgia. Hum Vaccine 2008; 4:238-45.
- Chidiac C, Bruxelle J, Daures JP, Hoang-Xuan T, Morel P, Leplege A, E , Hasnaoui A, de labareyre C: Characteristics of patients with HZ on presentation to practitioners in France. Clin Infect Dis 2001; 33:62–69.
- Schmader KE: Epidemiology and impact on quality of life of postherpetic neuralgia and painful diabetic neuropathy. Clin J Pain 2002; 18: 350–354.
- Mauskopf J, Austin R, Dix L, Berzon R: The Nottingham Health Profile as a measure of quality of life in zoster patients: convergent and discriminant validity. Qual Life Res 1994; 3:431-435.
- Boureau F, Legallicier P, Kabir-Ahmadi M: Tramadol in post-herpetic neuralgia: a randomized, double-blind, placebo-controlled trial. Pain 2003; 104:323-331.
- Saxena AK, Nasare N, Jain S, Dhakate G, Ahmed RS, Bhattacharya SN, Mediratta PK, Banerjee BD: A randomized, prospective study of efficacy and safety of oral tramadol in the management of post-herpetic neuralgia in patients from north India. Pain Pract 2013; 13:264-75.
- Nasare NV, Deshmukh PS, Banerjee, BD, Mediratta PK, Ahmed RS , Saxena AK, Bhattacharya SN: CYP2D6*4 polymorphism in tramadol treatment and its clinical impact in patients of post herpetic neuralgia Personalized medicine 2012; 9:371-385.
- Nasare NV, Banerjee, BD, Deshmukh PS, Mediratta PK, Saxena AK, Ahmed RS, Bhattacharya SN: CYP2D6*2 polymorphism as predictor of failed outpatient tramadol therapy in post herpetic neuralgia patients. Am J of Ther (Am J Ther. 2013 Apr 5. [Epub ahead of print])) 2013.
- Harati Y, Gooch C, Swenson M, Edelman S, Greene D, Raskin P, Donofrio P,Cornblath D, Sachdeo R, Siu CO, Kamin M: Double-blind randomized trial of tramadol for the treatment of the pain of diabetic neuropathy. Neurology 1998; 50:1842-1846.
- Hollingshead J, Du¨hmke RM and Cornblath DR: Tramadol for neuropathic pain. The Cochrane Database Systematic Reviews 2005; [Art. No.:CD003726].
- Sindrup SH, Andersen G, Madsen C, Smith T, Brøsen K, and Jensen TS: Tramadol relieves pain and allodynia in polineuropathy: a randomised, double-blind, controlled trial. Pain 1999; 83:85-90.
- Smith DG, Ehde DM, Hanley MA, Campbell KM, Jensen MP, Hoffman AJ, Awan AB, Czerniecki JM and Robinson LR: Efficacy of gabapentin in treating chronic phantom limb and residual limb pain. J Rehabil Res Dev 2005; 42(5):645-654.
- Cossmann M, Kohnen C, Langford R, McCartney C: Tolérance et séecurité d’emploi du tramadol. Résultats des études internationales et données de la pharmacovigilance. Drugs 1997; 53: 50–62.
- Lehmann KA, Kratzenberg U, Schroeder-Bark B, Horrichs-Haermeyer G: Postoperative patient-controlled analgesia with tramadol: analgesic efficacy and minimum effective concentrations. Clin J Pain 1990; 6:212-20.
- Follin SL, Charland SL. Acute pain management: operative or medical procedures and trauma. The Annals of Pharmacotherapy 1997; 31:1068-1076.
- Gan HG, Rusli I, Wan A, Wan Z: Impact of CYP2D6 Genetic polymorphism on tramadol pharmacokinetics and pharmacodynamics. Mol Diog Ther 2007; 11:171-181.
- Stamer UM, Stüber F, Muders T, Musshoff F: Respiratory depression with tramadol in a patient with renal impairment and CYP2D6 gene duplication. Anesth Analg 2008; 107:926-9.
- Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev 2002; 34: 383-448.
- Ingelman-Sundberg M: Genetic polymorphism of cytochrome P450 2D6 [CYP2D6]: Clinical consequences; evolutionary aspects and functional diversity. Pharmacogenomics J 2005; 5: 6-13.
- Candiotti KA, Yang Z, Rodriguez Y, Crescimone A, Sanchez GC, Takacs P, Medina C, Zhang Y, Liu H and Gitlin MC: The impact of CYP2D6 genetic polymorphisms on postoperative morphine consumption. Pain Med 2009; 10(5):799-805.
- Yang Z, Arheart KL, Morris R, Zhang Y, Rodriguez Y, Song C, Gitlin MC, and Candiotti KA: CYP2D6 poor metabolizer genotype and smoking predict severe postoperative pain in female patients on arrival to the recovery room. Pain Med 2012; 13(4):604-9.
- Paro HB, Morales NM, Silva CH, Rezende CH, Pinto RM, Morales RR, Mendonça TM, Prado MM. Health-related quality of life of medical students. Med Educ 2010; 44:227-35.
- Nageswararao D, Manjula G, Sailaja K, Raghunadharao S, Andvishnupriya RL: Association of CYP2D6*4 polymorphism with acute leukemia. J. Cell Tissue Res 2010; 10(2):2201–2205.
- Kirchheiner J, Keulen J-T HA, Bauer S, Roots I, Brockmöller J: Effects of the CYP2D6 gene duplication on the pharmacokinetics and pharmacodynamics of tramadol. J Clin Psychopharmacol 2008; 28:78–83.
- Wu CL, Raja SN. An update on the treatment of post herpetic neuralgia. J Pain 2008; 9: 519-530.
- Albert JM, van W, Mark W, Nagy M and Maarten van K: Herpes zoste rand Post-Herpetic Neuralgia. Pain Pract 2011; 11: 88–97.
- Capsaicin Study Group. Effect of treatment with capsaicin on daily activities of patients with painful diabetic neuropathy. Diabetes Care 1992; 15: 159-165.
- Davies PS and Galer, BS: Review of lidocaine patch 5% studies in the treatment of postherpetic neuralgia. Drugs 2004; 64:937-947.
- Gammaitoni AR, Alvarez NA, Galer BS: Safety and tolerability of the lidocaine patch 5%, a targeted peripheral analgesic: A review of the literature. J Clin Pharmacol 2003; 43:111-117.
- Torrance N, Smith BH, Watson MC, and Bennett MI: Medication and treatment use in primary care patients with chronic pain of predominantly neuropathic origin. Fam 2007; 24:481-485.
- Smith BH, Torrance N, Bennett MI, and Lee AJ: Health and quality of life associated with chronic pain of predominantly neuropathic origin in the community. Clin J Pain 2007; 23:143-149.
- Gore M, Brandenburg NA, Hoffman DL, Tai KS, Stacey B: Burden of illness in painful diabetic peripheral neuropathy: the patients' perspectives. The journal of Pain 2006; 7(12):892-900.
- McDermott AM, Toelle TR, Rowbotham DJ, and Schaefer CP, Dukes EM. The burden of neuropathic pain: results of a cross-sectional survey.Eur J Pain. 2006; 10:127-135.
- Jensen MP, Chodroff MJ, Dworkin RH. The impact of neuropathic pain on health-related quality of life. Review and implications 2007; 68:1178-1182.
- O'Connor AB: Neuropathic pain: quality-of-life impact, costs and cost effectiveness of therapy. Pharmacoeconomics 2009; 27(2):95-112.
- Berger WE, Ames DE, Harrison D: A patient satisfaction survey comparing levalbuterol with racemic albuterol in children. Allergy Asthma Proc. 2004; 25:437-44.
- Dworkin RH, O’Connor AB, Backonja M, Farrar JT, Finnerup NB, Jensen TS: Pharmacologic management of neuropathic pain: evidence-based recommendations. Pain 2007;132(3): 237-251
- Lachaine J, Gordon A, Choinière M, Collet JP, Dion D, Tarride JE: Painful neuropathic disorders: an analysis of the Régie de l'Assurance Maladie du Québec database. Pain research and Management 2007; 12(1):31-37.
- Schmader K, George LK, Burchett BM, Pieper CF, Hamilton JD: Racial differences in the occurrence of herpes zoster. J Infect Dis 1995; 171:701-4.
- Johnson RW, Bouhassira D, Kassianos G, Leplège A, Schmader KE, Weinke T: The impact of herpes zoster and post-herpetic neuralgia on quality-of-life. BMC Med 2010; 8:37.
- Opstelten W, Van Essen GA, Schellevis F, Verheij TJ, Moons KG. Gender as an independent risk factor for herpes zoster: a population-based prospective study.Ann Epidemiol 2006; 16: 692–695.
- Stamer UM, Lehnen K, Höthker F, Bayerer B, Wolf S, Hoeft A, Stuber F, Impact of CYP2D6 genotype on postoperative tramadol analgesia. Pain 2003; 105: 231–238.
- Wang G, Zhang H, He F, Fang X. Effect of the CYP2D6 * 10 C188T polymorphism on postoperative tramadol analgesia in a Chinese population. Eur J Clin Pharmacol 2006; 62:927–931.
- Slanar O, Dupal P, Matouskova O, Vondrackova H, Pafko, P, Perlik F: Tramadol efficacy in patients with postoperative pain in relation to CYP2D6 and MDR1 polymorphisms. Bratish Lek Listy 2012; 113(3):152-155.
- Zahari Z and Ismail R: Influence of cytochrome P450, family 2, subfamily D, and polypeptide 6 (CYP2D6) polymorphisms on pain sensitivity and clinical response to weak opioid analgesics. Drug Metab Pharmacokinet., 2013; Jun 11. [Epub ahead of print].
How to cite this article:
Nasare NV, Mediratta PK, Banerjee BV, Deshmukh PS, Saxena AK, Bhattacharya SN and Ahmed RS: The Treatment of Tramadol with Cream Containing 3.33% Doxepin and 0.05% Capsaicin on the Overall Improvement of Quality Of Life in Post Herpetic Neuralgia Patients. Int J Pharm Sci Res 2015; 6(4): 1568-78.doi: 10.13040/IJPSR.0975-8232.6(4).1568-78.
All © 2013 are reserved by International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
29
1568-1578
701
2305
English
Ijpsr
N. Vilas Nasare*, P. K. Mediratta, B. D. Banerjee , P. S. Deshmukh , A. K. Saxena , S. N. Bhattacharya and R. S. Ahmed
Department of Biochemistry, University College of Medical Sciences & G.T.B. Hospital, Delhi, India
ndharmul@gmail.com
03 August, 2014
13 October, 2014
19 January, 2015
10.13040/IJPSR.0975-8232.6(4).1568-78
01 April, 2015






