PROTECTIVE ROLE OF MELATONIN AND TAURINE AGAINST TOXICITY INDUCED BY CAFFEINE IN BRAIN BY ABROGATION OF OXIDATIVE STRESS, DECREASE APOPTOSIS, AND ALTERS CEREBRAL MONOAMINE NEUROTRANSMITTERS IN MALE ALBINO RATS
HTML Full TextPROTECTIVE ROLE OF MELATONIN AND TAURINE AGAINST TOXICITY INDUCED BY CAFFEINE IN BRAIN BY ABROGATION OF OXIDATIVE STRESS, DECREASE APOPTOSIS, AND ALTERS CEREBRAL MONOAMINE NEUROTRANSMITTERS IN MALE ALBINO RATS
Ragaa Abdallah Sayed, Sally Mostafa Khadrawy, Hanaa Mahmoud Mohamed and Magdy Sayed Aly *
Genetics Branch, Department of Zoology, Faculty of Science, Beni-Suef University, Beni-Suef 62511, Egypt.
ABSTRACT: The current study aimed to investigate the protective effects of taurine and melatonin against caffeine-induced brain damage in rats. 36 male albino rats were divided into 6 groups: Group I: control, group II: Rats received 20 mg/kg melatonin for 28 days. Group III: Rats received 50 mg/kg taurine dissolved in distilled water daily for 28 days. Group IV: Rats received 50 mg/kg caffeine dissolved in distilled water for 28 days. Group V: Rats received melatonin as described in group II in concomitant with caffeine, as described in group IV. Group VI: Rats received taurine as described in group III in concomitant with caffeine, as described in group IV. Caffeine-induced rats showed significantly increased brain lipid peroxidation, Superoxide dismutase (SOD) and reduced glutathione (GSH) content were significantly decreased. Monoamine neurotransmitters, gene and protein expression levels of p53 and Bax were significantly increased in the brain of caffeine-induced rats. In contrast, caffeine administration down-regulated Bcl-2 both gene and protein expression in the brain of rats. DNA damage were detected in caffeine treated group compared with control. Gene and protein expression levels of p53 and Bax were significantly decreased in the brain of taurine and melatonin administrated groups. Taurine and melatonin significantly decreased MDA and DNA damage, levels of dopamine and norepinephrine, and enhanced activity of the antioxidant enzymes in the brain of rats. In conclusion, taurine and melatonin can impact caffeine-induced oxidative stress and apoptosis through their antioxidant activity.
| Keywords: |
Caffeine, Melatonin, Taurine, Oxidative Stress, Apoptosis, Toxicity
INTRODUCTION: Caffeine (1,3,7-trimethyl-xanthine), a natural stimulatory compound, is probably the most consumed pharmacologically active compound in the world 1. Adults consume caffeine in tea and coffee; both contain natural caffeine in their beans or leaves 2.
Caffeine and other methylxanthines are used in clinical medicine as diuretics, analgesics, and muscle relaxants, and they can be used in the treatment of brain disorders such as headache 3. Caffeine had been found to have a role in the inhibition of motor symptoms and dopaminergic neurons loss in Parkinson’s disease 4. Moreover, excessive amounts of caffeine can adversely affect the body through significant toxic effects 5 including anxiety, delirium, headache, insomnia, nervousness, dehydration, hyperglycemia, and arrhythmia 6. In addition, high concentrations of caffeine induce cellular apoptosis 7, cell death 8.
Also, caffeine can cause indirect DNA damage as a result of the oxidative stress that it can cause 9. It is obviously not a harmless compound and may cause significant toxicity and even lethality 10, 11.
Melatonin (Nـacetyl-5-methoxytryptamine), an indole amine, acts as a hormone. It is secreted from the pineal gland during the night and also can be synthesized in the retina, bone marrow, gastro-intestinal tract, and skin 12. The level of this hormone is controlled by dark-light cycle, gender, age, seasons, and physiological conditions 13. Melatonin is an antioxidant, immune-modulator, anti-inflammatory agent, vaso-regulator, and oncostatic agent 14. It was reported that melatonin affects the morphological features of nerve tissues and had a neuroprotective role through involvement in the regeneration of peripheral nerves. Moreover, melatonin exerts a positive effect on axon length and development after peripheral nerve stress 15.
Melatonin is able to cross the blood-brain barrier easily, enter the central nervous system and the cerebrospinal fluid through the choroid plexus, where it can protect against various neuro-degenerative diseases and brain injury. Exogenous melatonin had been shown to decrease the cerebral infarction area and promote the neuronal anti-lipid peroxidation reaction, thus playing a role in brain protection 16. Many neurological disorders had been reported to be ameliorated by melatonin-administration, such as Alzheimer’s disease 17, stroke, traumatic brain injury and hypoxia 18.
Taurine, 2-aminoethane sulfonic acid, is a simple sulfur-containing organic acid. It is found in all animal cells. In particular, the electrically excitable tissue such as the heart, retina, brain, and skeletal muscles and liver of mammals 19.
Taurine accounts for 0.1% of the whole-body weight of human and present in its free form in all organs 20. It has antioxidant, anti-inflammatory, antiarrhythmic, and central nervous system neuromodulator effects.
Additionally, taurine stabilizes cell membranes, regulates levels of calcium ions in the blood and fatty tissues metabolism, regulates the development and function of skeletal muscle, the central nervous system, and the retina 21. Taurine also plays an important role in innate immunity 22.
MATERIALS AND METHODS:
Chemicals: Caffeine, Melatonin, Taurine, tri-chloroacetic acid (TCA), thiobarbituric acid (TBA), 1,1,3,3 tetramethoxypropane, pyrogallol, and 5,5′-dithiobis-(2- nitrobenzoic acid) (DTNB) were purchased from Sigma- Aldrich Chemical Co. (St. Louis, MO, USA). All other chemicals were of analytical grade and obtained from standard commercial supplies.
Experimental Animals: The experimental animals used in this work were 36 adult albino rats weighing about 120-150 g. They were obtained from the animal house of the National Research Center, El-Giza, Egypt. They were kept under observation for about 15 days before the onset of the experiment to exclude any intercurrent infection. The chosen animals were housed in plastic well-aerated cages (6 rats/cage) at normal atmospheric temperature and a normal 12-h light/dark cycle. The animals were not treated with antibiotics or insecticides, and they had free access to water and were supplied daily with a laboratory standard diet of known composition.
All animal procedures were in accordance with the recommendations of the Animal Ethics Committee of Beni-Suef University (Egypt), which conforms to the recommendations of the Canadian Committee for Care and Use of Animals 23.
Experimental Design: Experimental animals were divided into six equal groups:
Group I (Control): Rats received distilled water via oral gavage for 28 days.
Group II: Rats received 20 mg/kg melatonin dissolved in distilled water 24 via oral gavage daily for 28 days.
Group III: Rats received 50 mg/kg taurine dissolved in distilled water 25 via oral gavage daily for 28 days.
Group IV: Rats received 50 mg/kg caffeine dissolved in distilled water 26 via oral gavage daily for 28 days.
Group V: Rats received melatonin as described in group II in concomitant with caffeine, as described in group IV.
Group VI: Rats received taurine as described in group III in concomitant with caffeine, as described in group IV.
The doses of caffeine, melatonin, and taurine were balanced weekly as indicated by any change in body weight to keep up the comparable dosage for every kg body weight over the entire period of the experiment.
Blood and Tissue Sampling: At the end of the experimental period, animals were fasted overnight but allowed free access to water. Animals were sacrificed under mild anesthesia by diethyl ether, and blood samples were obtained from the carotid artery. Animals were decapitated and dissected, then brain tissues were rapidly excised and immediately perfused with ice-cold saline (0.9% sodium chloride). Blood samples were left for 15 min at a temperature of 25 °C to coagulate, then centrifuged at 5000 rpm for 10 min, and clear non-hemolyzed sera were collected and kept at -20 °C until used. Brain samples (10% w/v) were homogenized in chilled phosphate-buffered saline and the homogenates were centrifuged at 3000 rpm for 10 min at 4 °C by Centurion Scientific K3 cooling centrifuge (UK) to separate the nuclear debris. The clear homogenates were collected and stored at -20 °C until used. Also, brain specimens were preserved in -70 °C for gene expression analysis and western blot analysis.
Biochemical Assays:
Assay of Oxidative Stress and Antioxidant Defense System: Lipid peroxidation was estimated in brain homogenate by measuring malondi-aldehyde (MDA) levels following the method of Preuss et al. 27 Reduced glutathione (GSH) content and superoxide dismutase (SOD) activity were estimated following the methods of Beutler et al., 28 and Marklund and Marklund 29 respectively.
RNA Isolation and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR): Gene expression analysis of P53, BAX, and Bcl2 in brain samples was carried out by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Total RNA was isolated from frozen brain samples using TRIzol reagent, treated with DNase I, and quantified at 260 nm. cDNAs were synthesized from 2 mg RNA and were amplified using SYBR Green master mix (Thermo Fisher Scientific, USA) with the primer sets outlined in Table 1. The obtained amplification data were analyzed by the 2-ΔΔCt method 30, and the values were normalized to β-actin.
TABLE 1: PRIMER PAIRS USED FOR PCR
| Gene | Gene Bank accession number | Sequence 5΄–3΄ |
| BAX | NM_007527 | F: 5′ CGAGCTGATCAGAACCATC3' |
| R: 5′ GAAAAATGCCTTTCCCCTTC3' | ||
| Bcl2 | NM_009741 | F: 5′ TAAGCTGTCACAGAGGGGCT3' |
| R: 5′ TGAAGAGTTCCTCCACCACC3' | ||
| P53 | NM_022112 | F: 5′ GCTGCCCTCCCTTCTCCTAG3' |
| R: 5′CCCCGACTTTGGAGTAGTCTGA3' |
Western Blotting Analysis: Brain samples kept at −70 °C were used to investigate the effect of caffeine on the expression level of P53, BAX and Bcl2 using β-actin as a loading control using chemiluminescence kit (BIORAD, USA) 31.
Detection of DNA Single Strand Breaks (Comet Assay): The alkaline comet assay was performed as described by Singh et al. 32 To obtain single cells from brain, sample must be finely minced using sterile scissors or scalpels, cell dispersion can be achieved by enzymatic digestion of the sample using collagenase. A freshly prepared 10µL of single liver cells (10,000-50,000) in cold Hank’s Balanced Salt Solution (HBSS) was mixed with 65µL of 0.7 low melting point agarose (LMA) at 37 °C and spread onto microscope slide pre -coated with 0.5 % normal melting point agarose (NMA) and the slide was covered with a third layer of LMA and a cover slip was applied to spread the sample.
The cells then lysed in lysis buffer consisting of 1% sodium sarcosinate, 2.5 M NaCl, 10 mM Na2 EDTA, 1% Triton x -100, 10% DMSO and 10mM Tris, pH10 for 1 h at 4 °C. After the lysis, the slides were placed in an electrophoresis unit, the DNA was allowed to unwind for 20 min in the electrophoretic solution consisting of 300 mM NaOH, 1 mM EDTA, pH>13. Electrophoresis was conducted at ambient temperature of 4°C for 20 min at electric field strength of 300 mA. The slides were then neutralized with 0.4 M Tris, pH7.5, stained with 2 µg/ml ethidium bromide and covered with cover slips.
To prevent additional DNA damage, all the steps described above were conducted under dimmed light or in the dark. The slides were viewed under a LeitzOrthoplan epifluorescence microscope (magnification 200x) equipped with an excitation filter of 515-550 nm and a barrier filter of 590 nm. The microscope was connected through a camera to a computer-based image analysis system (Comet Assay IV software). For each sample, 100 isolated comets (single-strand breaks of DNA migrate from nucleus to anode) were randomly selected and measured for comet tail length, % DNA in tail, and tail moment according to the definition by Olive and Banath (1993) 33.
Tail moment = Tail length X % DNA in tail / 100
Estimation of Monoamines in Different Brain Tissue Regions: The determination of norepinephrine (NE) and dopamine (DA) content was carried out according to Ciarolone 34. In this fluorometric assay, the monoamines are first oxidized to their "adrenochromes", and then re-arranged to their "adrenolutins", which are then detected by specific fluorescence at particular wave lengths of excitation and emission. Each brain region was separately weighed then homogenized in ice-cold solution of n-butanol (10ml/g tissue) then centrifuged at 4,000 rpm for 10 min at 4 ºC in a Heraeus Sepatech centrifuge. A volume of 2.5ml of each supernatant was transferred to a tube containing 1ml of 0.2N acetic acid and 5ml n-heptane. The tubes were then placed on a vortex mixer for 30 sec and centrifuged at 1000 rpm for 5 min. The organic supernatant was discarded from the aqueous phase, and 1 ml of the aqueous phase was transferred to another tube for the determination of NE and DA.
Determination of Norepinephrine (NE) and Dopamine Contents (DA): A volume of 0.2ml of EDTA was mixed with 1ml of supernatant, and then 0.1ml of 0.1N iodine was added and shook well for 2 min followed by 0.2ml of alkaline sulphite added with shaking for further 2 min. Finally, 0.2ml of 5N acetic acid was added and shook well while blank tube was prepared by adding 0.2 ml of 0.2N acetic acid instead of supernatant. For determination of norepinephrine the tubes were placed in boiling water bath for 2 min then cooled under tap water and the fluorescence was read at excitation 380 nm and emission 480 nm using Hitachi (F3010 model) spectrophotofluorometer. For the determination of dopamine, the tubes were placed in boiling water bath for 40 min then were cooled under tap water, and the fluorescence was read at excitation 320 nm and emission 480 nm using Hitachi (F3010 model) spectrophotofluorometer.
RESULTS:
Melatonin and Taurine Attenuate Oxidative Stress in Brain of Caffeine-Administered Rats: Caffeine-administered rats showed a significant (P < 0.05) increase in MDA, a marker of lipid peroxidation, when compared to the respective normal rats. Concurrent treatment with either melatonin or taurine for 28 days significantly (P < 0.05) decreased brain MDA content. In contrast, GSH content and activity of the antioxidant enzyme SOD in the brain of caffeine-administered rats were significantly (P < 0.05) declined. Rats treated with melatonin and taurine significantly (P < 0.05) prevented GSH decline and ameliorated SOD activity in rats brain Fig. 1.
FIG. 1: MELATONIN AND TAURINE AMELIORATED THE OXIDATIVE STRESS EFFECT INDUCED BY CAFFEINE IN BRAIN OF CAFFEINE-ADMINISTERED RATS. (A) MDA, MALONDIALDEHYDE; (B) GSH, GLUTATHIONE; (C) SOD, SUPEROXIDE DISMUTASE. Data are expressed as Mean ± SD (N = 6). aSignificantly different from control group, bSignifficantly different from caffeine group at p ˂ 0.05
Melatonin and Taurine Prevent DNA Damage in Brain of Caffeine-Administered Rats: To further explore the protective effects of melatonin and taurine against caffeine toxicity, oxidative DNA damage was determined using comet assay. The data represented in Fig. 2 and 3 show the effect of melatonin and taurine on DNA fragmentation in brain of control and caffeine-administered rats. Caffeine significantly (P < 0.05) increased DNA fragmentation as showed from the tail length and DNA% in comet tail. Oral supplementation of either melatonin or taurine for 28 days significantly (P < 0.05) attenuated DNA fragmentation in brain of caffeine-administered rats.
FIG. 2: MELATONIN AND TAURINE AMELIORATED THE INDUCED DNA DAMAGE IN BRAIN OF CAFFEINE-ADMINISTERED RATS. PHOTOMICROGRAPHS OF COMET ASSAY SHOWING DNA MIGRATION PATTERN IN BRAIN TISSUE FROM (A) CONTROL RATS, (B & C) NORMAL RATS TREATED WITH MELATONIN AND TAURINE, RESPECTIVELY. ALL OF WHICH SHOWING NORMAL SPOTS AND ROUND UNTAILED SHAPE (ARROWS), (D) CAFFEINE ADMINISTERED RATS SHOWING INCREASED NUMBER OF DAMAGED SPOTS WITH TAILED SHAPES (HEAD ARROWS) , (E&F) CAFFEINE ADMINISTERED RATS TREATED WITH MELATONIN AND TAURINE, RESPECTIVELY SHOWING DECREASED NUMBER OF DAMAGED SPOTS
FIG. 3: MELATONIN AND TAURINE AMELIORATED THE DNA DAMAGE INDUCED BY CAFFEINE IN BRAIN OF CAFFEINE-ADMINISTERED RATS. PHOTOMICROGRAPHS OF COMET ASSAY SHOWING DNA MIGRATION PATTERN IN BRAIN TISSUE FROM (A) CONTROL, (B) CONTROL + MELATONIN (C) CONTROL + TAURINE, (D) CAFFEINE ADMINISTERED RATS, (E) CAFFEINE + MELATONIN AND (F) CAFFEINE + TAURINE
Melatonin and Taurine Exacerbate the Caffeine Effect on Neurotransmitters in Brain of Caffeine-Administered Rats: Dopamine and norepinephrine level Table 2 in brain of caffeine-administered rats showed a significant (P < 0.05) elevation as compared to their respective normal controls. Melatonin and taurine supplementation produced a significant (P < 0.05) amelioration in both dopamine and norepinephrine levels as compared to caffeine administered rats.
TABLE 2: AMELIORATIVE EFFECT OF MELATONIN AND TAURINE ON NEUROTRANSMITTERS IN BRAIN OF CAFFEINE-ADMINISTERED RATS. (A) DA, DOPAMINE IN PICOGRAM/MILLILITER; (B) NE, NOREPI-NEPHRINE IN PICOGRAM/MILLILITER
| Group / Parameter | Control | Melatonin | Taurine | Caffeine | Caffeine + Melatonin | Caffeine+
Taurine |
| Dopamine (Pg/ml) | 33.90 ± 1.10 | 39.33 ± 2.17 | 38.28 ± 1.08 | 98.87 ± 8.81a | 67.77 ± 3.26b | 58.00 ± 3.27b |
| Norepinephrine (Pg/ml) | 69.68 ± 4.48 | 79.28 ± 3.83 | 69.92 ± 2.12 | 136.70 ± 2.60a | 93.80 ± 8.77b | 87.77 ± 8.73b |
Data are expressed as Mean ± SD (N = 6). aSignificantly different from control group, b Significantly different from caffeine group at p ˂ 0.05
Melatonin and Taurine Prevent Apoptosis in Brain of Caffeine-Administered Rats: Caffeine significantly (P < 0.05) increased the level of P53 and BAX gene and decreased Bcl2 gene expression in the brain of caffeine-administered rats as compared to their respective normal controls.
FIG. 4: AMELIORATIVE EFFECT OF MELATONIN AND TAURINE ON APOPTOSIS INDUCED BY CAFFEINE IN BRAIN OF CAFFEINE-ADMINISTERED RATS. (A) BAX, APOPTOSIS REGULATOR; (B) Bcl-2, (B-CELL LYMPHOMA-2), ANTI-APOPTOTIC MARKER; (C) P53, TUMOR SUPPRESSOR GENE. Data are expressed as Mean ± SD (N = 6). aSignificantly different from control group, b Significantly different from caffeine group at p ˂ 0.05
Treatment with either melatonin or taurine for 28 days markedly (P < 0.05) decreased brain level of P53 and BAX gene and increased Bcl2 gene in the brain of caffeine-administered rats. In the same trend, the protein expression level of P53 and BAX significantly (P < 0.05) increased in the brain of caffeine-administered rats, and Bcl2 protein expression level decreased. Co-treatment with either melatonin or taurine for 28 days markedly (P<0.05) decreased brain expression level of P53 and BAX protein and increased Bcl2 protein expression in the brain of caffeine-administered rats Fig. 4.
DISCUSSION: Caffeine is present in energy drinks, drugs, several food and beverage products, such as coffee, tea, and carbonated. It is probably the most commonly consumed pharmacologically active compound in the world 1, 35. Some of the effects of caffeine could favor the generation of free radicals and lead to a subsequent increase in oxidative stress by increasing lipid peroxidation 36. Although the wide use of caffeine in productions, its increasing consumption, and the conflicting results that had been generated by using of variable forms of caffeine and experimental methods little attention has been paid towards the study of its possible toxicity.
The present investigation evaluates the possible protective role of melatonin and taurine against caffeine toxic effects on the brain of rats, focusing on oxidative stress, inflammation, oxidative DNA damage, apoptosis, and monoamine neuro-transmitters.
The total antioxidant capacity is determined by measuring the markers of oxidative stress. MDA has been reviewed as a primary biomarker of free radical mediated oxidative stress and lipid damage 37. The results showed the prooxidant effect of caffeine administration, evidenced by the significantly increased levels of MDA. Caffeine has been reported to induce the generation of ROS and eventually to result in oxidative stress as indicated by increased lipid peroxidation activity 38. Choi et al., 39 supposed that coffee or its metabolites can be pro-oxidant and can increase lipid peroxidation. Similarly, Leelarungrayub et al. 40 reported a significant increase in MDA level in men consuming caffeinated coffee, when compared to decaffeinated coffee or control, followed by a submaximal exercise test. In the same trend, Metro et al., 41 demonstrated an increased intramuscular fat oxidation after caffeine-rich food consumptions.
In contrast, caffeine-induced rats showed a significant decline in brain GSH content. GSH has been considered as a biomarker of redox imbalance at the cellular level and the most abundant non protein thiol that defends against oxidative stress 37. Intracellular GSH depletion significantly promotes mitochondrial ROS production and triggers mitochondrial membrane depolarization 42. The declined GSH might be due to nicotinamide adenine dinucleotide phosphate (NADPH) depletion or increased consumption of GSH in non-enzymatic removal of oxygen-radicals 43.
In addition, reduced activity of the antioxidant enzyme SOD was observed in the brain of the caffeine-induced rats. SOD has been reported as an important defense enzyme that catalyzes the partitioning of superoxide radical, which produces hydrogen peroxide (H2O2) that is turned into H2O and molecular oxygen by catalase 44. In agreement with our findings, Cruz et al., 45, and Ekaluo et al. 46 concluded that caffeine could cause lipid peroxidation and decrease the GSH content and SOD activity in molluscs (Ruditapes philippinarum) and rats, respectively.
These changes were significantly ameliorated by melatonin and taurine administration, which reduced the MDA level and increased GSH content and SOD activity. The ameliorative effect of melatonin could be attributed to its free radical scavenging ability. It prevents peroxidation, which is a common feature of other antioxidants. Also, it had been found to be more potent than glutathione and mannitol in hydroxyl radical scavenging activity and decrease the nitric oxide synthase (NOS) activity that is a pro-oxidative enzyme 47. In addition to its highly free radical scavenging capacity, its metabolites are in a series of reactions that is known as the melatonin antioxidative cascade 48, 49. This function relies only on melatonin's chemical structure, it reacts directly with free radicals and neutralizes their oxidative effects, and the same is true for its metabolites. No cell receptor is required to achieve this effect.
Hence, this function cannot be lost through evolution 50. It has been reported that natural antioxidants such as vitamin E and melatonin might decrease MDA level and increase the activities of GSH levels in pathological conditions induced by oxidative stress 51. It ameliorates oxidative tissue and DNA damage resulting from formaldehyde-induced toxicity, decreases MDA level, and increases GSH level in lung, liver, and kidney 52.
According to Wang et al., 53 melatonin up-regulated the relative expression of the antioxidant enzyme SOD during in-vitro embryo development. Moreover, in an experimental model of carbon tetrachloride (CCl4)-induced liver injury, melatonin treatment attenuated liver injuries and diseases by inhibiting oxidative damage and other mechanisms. It increased SOD and GSH activity and decreased MDA level 54.
The ameliorative effect of taurine could be attributed to be a free radical scavenger, membrane stabilizer and hypolipidemic agent 55. Some investigations indicated that taurine’s antioxidant actions are related to the up-regulation of the activity of the antioxidant enzymes and reducing the amount of damaging ROS. Thus, taurine is able to indirectly elevate the activity of the antioxidant defenses. Also, taurine acts as an important anti-inflammatory agent, which includes a myeloperoxidase-catalyzed reaction between taurine and hypochlorous acid to generate an anti-inflammatory product, taurine chloramine. However, through the myeloperoxidase reaction, taurine also decreases the levels of the neutrophil-generated ROS, hypochlorous acid. Furthermore, its intra-mitochondrial depletion is connected to up-regulation in mitochondrial superoxide generation, leading to the suggestion that the mitochondria are the primary source of ROS generated by taurine deficient tissues 56, 57. Also, taurine advances the synthesis of GSH and raises the action of GPx, and this could be the mechanism of enzymatic antioxidant defense 58.
In the other hand, taurine increases SOD activity in a dose-dependent manner 59. Additionally, NIU et al. 60 reported that taurine supplementation was reported to be effective against oxidative stress, apoptosis, and inflammation in injured brain cells, it significantly decreased MDA content and increased GSH and SOD content in injured brain cells.
Reactive oxygen species can react with DNA, carbohydrates, proteins, and lipids in a destructive manner as a result of their high levels of chemical reactivity. Therefore, ROS are considered as DNA-damaging agents that promote oncogenic transformation, increase mutation rates, and function as cellular messengers in redox signaling, causing disruptions in normal mechanisms of cellular signaling 61. The increase of oxidative stress results in double-strand DNA breaks 62. The present study revealed that caffeine significantly increased DNA fragmentation as showed from the tail length and DNA% in the comet tail. As shown in the comet assay results, oral supplementation of melatonin and taurine significantly attenuated DNA fragmentation in the brain of caffeine-administered rats. These findings are consistent with Schmid et al. 63, who found that men with high caffeine consumption had significantly higher frequencies of sperm comet values with DNA damage compared to men with less caffeine consumption. Genotoxicity of caffeine was also reported by Selby and Sancar 64, who concluded that caffeine can intercalate into the DNA molecule of bacteria and block repair enzymes, and Aguirre-Martínez et al., 9 who found damage in the DNA of hemocytes of the Asian clam Corbicula fluminea after a 21-day exposure to caffeine.
Reiter et al., 65 reported that the first primary function of melatonin is to protect cells from oxidative stress, avoiding DNA, RNA, proteins, and membrane cell damage through its free radical scavenger capacity. Melatonin protects oocytes from DNA damage during prophase arrest by enhancing DNA repair via non-homologous end‐joining (NHEJ) pathway and subsequently prevents the deterioration of oocyte quality during meiotic maturation 66. In the same trend, it had been found that melatonin enhances the repair of oxidized DNA. This is maybe due to the ability of melatonin to transform guanosine radical to guanosine by electron transfer 67. Moreover, it was reported that melatonin diminished the formation of 8-hydroxy-2́՜-deoxyguanosine (8-OH-dG), a damaged DNA product, 60–70 times more effective than some classic antioxidants (ascorbate and α-tocopherol) 68.
In the same trend, the ameliorative effect of taurine agreed with Abd El-Twab et al., 69, who found that oral supplementation of taurine for 6 weeks ameliorated ROS-induced DNA damage in testicular tissue of the diabetic rats. Another study reported that taurine treatment prior to KBrO3 significantly attenuated DNA damage and DNA-protein cross-linking caused by KBrO3 to the rat intestine 70.
Biochemically, the main action of caffeine is antagonism of adenosine A1 and A2 receptors. Neuropsychiatric effects are mediated largely by blockade of A1 and A2 receptors in the CNS. Adenosine A1 receptors are present in almost all brain areas, but particularly in the cerebral cortex, hippocampus, thalamus, and cerebellar cortex 71. Caffeine acting as an antagonist of A2AR may inhibit an important A2 AR-mediated tissue-protecting mechanism. Also, this suggested that caffeine might trigger tissue damage if consumed during an acute inflammation episode 72. Caffeine has been indicated to occupy adenosine receptors and then block the neurotransmitter action. Adenosine receptors relate to interplay of release, reuptake, metabolism, and excretion of neurotransmitters 73.
We found that caffeine markedly elevated dopamine and norepinephrine levels in brain, while melatonin and taurine significantly down-regulated the level of dopamine and norepinephrine in the brain of caffeine-administered rats. Our observations were in a line with Volkow et al. 74, who interpreted that caffeine’s DA-enhancing effects in the human brain are indirect and mediated by an increase in D2/D3R levels and/or changes in D2/D3R affinity. Also, norepinephrine level increased after caffeine treatment. These observations agree with Smith et al., 75 who concluded that caffeine opposes the reduction in the turnover of central noradrenaline.
There are links between adenosine A2A receptors and the dopaminergic system in the brain. As adenosine inhibits dopaminergic neurotransmission, blockade of A2A receptors by caffeine may increase dopaminergic activity and exacerbate psychotic symptoms 76. The inhibitory action of melatonin on enhanced dopamine release was first demonstrated in excised female rat hypothalamic tissue in vitro, and it appears to be mediated by membranal, low-affinity melatonin binding sites by suppression of calcium influx into the stimulated nerve endings 77. Melatonin inhibits dopamine release in the retina and mesencephalic dopamine areas 78. It was reported that melatonin enhanced norepinephrine content in the adrenal medulla of chronically stressed rats 79.
The function of the neurotransmitter implies the existence of specific taurine receptors and the neuromodulator role of interference with the functions of other transmitter systems 80. Taurine injection within the Substantia nigra reduces extracellular dopamine 81 and modulates striatal dopaminergic transmission 82, but another study reported that direct injection of taurine into the striatum had significantly increased extracellular dopamine 83.
Also, Chen et al., 84 report a significantly lower dopamine uptake was detected in the striatal synaptosomes of SHR rats that were fed with high-dose taurine than those of the controls. It also affects norepinephrine uptake and releases in rat cerebral cortical slices 85. Pretreatment of taurine reduced the levels of dopamine, noradrenaline, and 5-hydroxytryptamine. Moreover, taurine triggers the elevation of striatal dopamine is dependent on impulse flow 86.
Increased ROS are related to excess cell loss and mediate the induction of apoptosis in various cell types 87, 88. Our findings showed that caffeine increased P53 and BAX gene and protein expression levels but decreased Bcl-2 gene and protein expression levels in the brain. Treatment with melatonin and taurine significantly ameliorated these changes.
Several reports showed that high concentrations of caffeine induce cellular apoptosis 7. Our observations were in line with Lu et al., 7, who found that treatment of osteoblasts with more than 0.5 mM caffeine triggered an increase in Bax and a decrease in Bcl-2 protein levels. Bax and Bcl-2 regulate changes in the mitochondrial membrane potential (MMP) and permeability, which play important roles in apoptotic processes 89. Another study was carried out by He et al., 8 who showed that the mechanism of induction of apoptosis in JB6 Cl41 cells by caffeine involved activated p53, Bax, and caspase 3. It has been reported that caffeine had a mechanistic effect on cell cycle function, triggered apoptosis, and perturb key regulatory proteins, including the tumor suppressor protein p53 90.
Melatonin supplementation upregulated the antiapoptotic Bcl-2 level and decreased the proapoptotic Bax level. The ability of melatonin to enhance the Bcl-2 level has been shown in rat brain and has an antiapoptotic role 91. Furthermore, an in vitro study by Wang et al., 53 proved the anti-apoptotic effect of melatonin by increasing Bcl-2 level and down-regulating the pro-apoptotic gene p53. Our results are also consistent with Juknat et al. 92, who found a decrease in Bax expression after pre-incubation of cultured rat astrocytes with 10 nm melatonin. Melatonin significantly decreased the mRNA and protein expression of BAX, while it enhanced the mRNA and protein expression of Bcl-2 of mouse Leydig cells, melatonin at concentrations of 10 and 100 ng/mL for 36 hours 93. Melatonin protective effects appear to be associated with its antioxidant ability, which limits intra-mitochondrial glutathione loss and reduces mitochondrial protein damage and improves the electron transport chain activity 94, 95.
Under the condition of apoptosis, apoptotic cells undergo an exaggerated activation of the regulatory volume decrease in which taurine effluxes the cell. If the regulatory volume decrease is disrupted by preloading the cells with taurine several apoptotic steps, such as apoptotic cell shrinkage and DNA fragmentation, are blocked 96. Although taurine loading did not inhibit early apoptotic events, such as caspase activation, it blocked the progression of the apoptotic cascade beyond the cell shrinkage step 96. NIU et al., 60 found that taurine supplementation significantly reduced P53, caspases-3, and BAX mRNA expression and increased Bcl-2 mRNA expression in injured brain cells. Also, taurine significantly inhibited myocardial H/R-induced apoptosis, and the mechanism may be related to a down-regulated expression of PUMA 97.
CONCLUSION: Our study showed the protective effect of melatonin and taurine against caffeine toxicity in rat brain. The results revealed that caffeine increased oxidative stress by increasing MDA and decreasing GSH content and SOD activity. From comet assay results, caffeine caused DNA damage as shown from DNA fragmentation and tail %. Caffeine-administered rat showed markedly high levels of dopamine and norepi-nephrine, as well as significantly high levels of apoptotic markers, BAX and P53, and lower antiapoptotic Bcl-2. Melatonin and taurine ameliorated all of caffeine toxic effects.
As shown from our results, taurine appears to be more potent against caffeine toxicity than melatonin. From this point of view, taurine and melatonin can impact upon caffeine-induced oxidative stress and apoptosis through their antioxidant activity.
ACKNOWLEDGEMENT: The author thanks the Department of Zoology, Faculty of Science, Beni-Suef University, for providing the lab facilities for the present research work.
CONFLICTS OF INTEREST: The authors declare that they have no competing interests.
REFERENCES:
- Taalat MS, Aly EM, Mohamed ES, Ali MA and Gaber HA: Caffeine and nifedipine effect on cataract induced by selenite in rats. J Arab Soc Med Res 2018; 13: 32-38.
- Fulgoni VL, Keast DR and Lieberman HR: Trends in intake and sources of caffeine in the diets of US adult: 2001-2010. AM J Clin Nutr 2015; 101: 1081-87.
- Koblihová E, Lukšan O and Mrázová I: Hepatocyte transplantation attenuates the course of acute liver failure induced by thioacetamide in Lewis rats. Physiol Res 2015; 64: 689-700.
- Cappelletti S, Piacentino D, Sani G and Aromatario M: Caffeine: cognitive and physical performance enhancer or psychoactive drug? Curr Neuropharmacol 2015; 13(1): 71-88.
- Tsvetkova DD, Klisurov RC, Pankova SA and Zlatkov BA: investigation of some pharmacological effects of caffeine and taurine in food supplements. International Journal of Nutrition and Food Sciences. Special Issue: Taurine and Caffeine Supplementation in Energy Food Drinks: Uses, Side Effects and Quality Control 2015; 4: 18-23.
- Pelchovitz DJ and Goldberger JJ: Caffeine and cardiac arrhythmias: a review of the evidence, Am J Med 2011; 124: 284-89.
- Lu PZ, Lai CY and Chan WH: Caffeine induces cell death via activation of apoptotic signal and inactivation of survival signal in human osteoblasts. Int J Mol Sci 2008; 9(5): 698-718.
- He Z, Ma WY, Hashimoto T, Bode AM, Yang CS and Dong Z: Induction of Apoptosis by Caffeine Is Mediated by the p53, Bax, and Caspase 3 Pathways. Cancer Res 2003; 63: 4396-401.
- Aguirre-Martínez GV, DelValls TA and Martín-Díaz ML: Yes, caffeine, ibuprofen, carbamazepine, novobiocin and tamoxifen have an effect on Corbicula fluminea (Müller, 1774). Ecotoxicol Environ Saf 2015; 120: 142-54.
- Jones AW: Review of caffeine-related fatalities along with postmortem blood concentrations in 51 poisoning deaths. J Anal Toxicol 2017; 41: 167-72.
- Willson C: The clinical toxicology of caffeine: A review and case study. Toxicol Rep 2018; 5: 1140-52.
- Slominski AT, Hardeland R, Zmijewski MA, Slominski RM, Reiter RJ and Paus R: Melatonin: A cutaneous perspective on its production, metabolism, and functions. J Invest Dermatol 2018; 138: 490-99.
- Talib WH: Melatonin and Cancer Hallmarks. Molecules 2018; 23(3): 518.
- Zare H, Shafabakhsh R, Reiter RJ and Asemi Z: Melatonin is a potential inhibitor of ovarian cancer: molecular aspects. J Ovarian Res 2019; 12(1): 26.
- Uyanikgil Y, Cavusoglu T, Kılıc KD, Yigitturk G, Celik S, Tubbs RS and Turgut M: Useful effects of melatonin in peripheral nerve injury and development of the nervous system. J Brachial Plex Peripher Nerve Inj 2017; 12(1): 1-6.
- Qiu T and Xu M: Neuroprotective and regenerative effects of melatonin on hypoxic-ischemic brain injury in neonatal rats. Int J Clin Exp Med 2016; 9(5): 8014-22.
- Srinivasan V, Pandi-Perumal SR, Cardinali DP, Poeggeler B and Hardeland R: Melatonin in Alzheimer’s disease and other neurodegenerative disorders. Behav Brain Funct 2006; 2: 15.
- Hardeland R: Brain Inflammaging: Roles of Melatonin, Circadian Clocks and Sirtuins. J Clin Cell Im 2018; 9: 543.
- Zaorska E, Tomasova L, Koszelewski D, Ostaszewski R and Ufnal M: Hydrogen sulfide in pharmacotherapy, beyond the hydrogen sulfide-donors. Biomolecules 2020; 10(2): 323.
- Tu S, Zhang XL, Wan HF, Xia YQ, Liu ZQ, Yang XH and Wan FS: Effect of taurine on cell proliferation and apoptosis human lung cancer A549 cells. Oncol Lett 2018; 15(4): 5473-80.
- Schaffer S and Kim HW: Effects and mechanisms of taurine as a therapeutic agent. Biomol Ther (Seoul) 2018; 26(3): 225-41.
- Nagl M, Hess MW, Pfaller K, Hengster P and Gottardi W: Bactericidal activity of micromolar N-chlorotaurine: Evidence for its antimicrobial function in the human defense system. Antimicrob Agents Chemother 2000; 44: 2507-13.
- Canadian Council on Animal Care, 1993.
- Farhadi M, Jameie SB, Kouchmeshki A, Janzadeh A, Hayat P and Kerdari M: Effects of exogenous melatonin on Bax and P53 expression in Substantia nigra of adult rat menopause model following pinealectomy. International Journal of Cellular & Molecular Biotechnology 2014; 1-8.
- Sankar Samipillai S, Jagadeesan G, Thamizh-Selvi K and Sivakumar K: Protective effect of taurine against mercury induced toxicity in rats. International Journal of Current Research 2010; 1: 023-029.
- Emmanuel A, Majesty D, Benjamin A, Peter A and Princess U: Effect of Caffeine on Some Selected Biochemical Parameters Using Rat Model. Adv Biol Res 2017; 1-9.
- Preuss HG, Jarrel ST, Scheckenobach R, Lieberman S and Anderson RA: Comparative effects of chromium vanadium and Gymnema sylvestre on sugar-induced blood pressure elevations in SHR. J Am College Nutr 1998; 17(2): 116-23.
- Beutler E, Duron O and Kelly BM: Improved method for determination of blood glutathione. J Lab Clin Med 1963; 61: 882-88.
- Marklund S and Marklund G: Involvement of superoxide anion radical in the autooxidation of pyrogallol and convenient assay for superoxide dismutase. Eur J Biochem 1974; 47: 469-74.
- Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods 2001; 25(4): 402-08.
- Mahmoud AM, Germous MO, Alotaibi MF and Hussein O: Possible involvement of Nrf2 and PPAR gamma upregulation in the protective effect of umbelliferone against cyclophosphamide- induced hepatotoxicity. Biomed Pharmacother 2017; 86: 297-306.
- Singh NP, McCoy MT, Tice RR and Schneider EL: A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 1988; 175: 184-91.
- Olive PL and Banáth JP: Detection of DNA double-strand breaks through the cell cycle after exposure to X-rays, bleomycin, etoposide and 125IdUrd. Int J Radiat Biol 1993; 64: 349-58.
- Ciarolone AE: Further modification of fluorometric method foranalyzing brain amines. Microchem J 1978; 23: 9-12.
- Verster JC and Koenig J: Caffeine intake and its sources: A review of national representative studies. Crit Rev Food Sci Nutr 2018; 58(8): 1250-59.
- Schmitt GC, Arbo MD, Lorensi AL, Jacques ALB, Nascimento SN, Mariotti KC, Garcia SC, Dallegrave E, Leal MB and Limberger RP: Gender differences in biochemical markers and oxidative stress of rats after 28 days oral exposure to a mixture used for weight loss containing p-synephrine, ephedrine, salicin, and caffeine. Braz. J. Pharm. Sci 2016; 52(1): 59-68.
- Droge W: Free radicals in the physiological control of cell function. Physiol 2002; 82: 47-95.
- Uno UU, Umoyen AJ and Ekaluo UB: Mitigating Effect of Honey on Caffeine Induced Oxidative Stress in Male Albino Rats. Journal of Scientific Research & Reports 2018; 21: 1-7.
- Choi EY, Jang JY and Cho YO: Coffee intake can promote activity of antioxidant enzymes with increasing MDA level and decreasing HDL-cholesterol in physically trained rats. Nutrition Research and Practice 2010; 4: 283-89.
- Leelarungrayub D, Sallepan M and Charoenwattana S: Effects of acute caffeinated coffee consumption on energy utilization related to glucose and oxidation from short submaximal Treadmill exercise in sedentary Men. Nutr Metab Insights 2011; 4: 65-72.
- Metro D, Cernaro V, Santoro D, Papa M and Buemi M: Beneficial effects of pure caffeine on oxidative stress. Journal of Clinical & Translational Endocrinology 2017; 10: 22-27.
- Lohan SB, Vitt K, Scholz P, Keck CM and Meinke MC: ROS production and glutathione response in keratinocytes after application of β-carotene and VIS/NIR irradiation. Chem Biol Interact 2018; 280: 1-7.
- Gumieniczek A: Effects of repaglinide on oxidative stress in tissues of diabetic rabbits. Diabetes Res Clin Pract 2005; 68(2): 89-95.
- Younus H: Therapeutic potentials of superoxide dismutase. Int J Health Sci (Qassim) 2018; 12(3): 88-93.
- Cruz D, Almeida A, Calisto V, Esteves VI, Schneider RJ, Wrona FJ, Soares AMVM, Figueira E and Freitas R: Caffeine impacts in the clam Ruditapes philippinarum: alterations on energy reserves, metabolic activity and oxidative stress biomarkers. Chemosphere 2016; 160: 95-103.
- Ekaluo UB, Uno UU, Edu NE, Ekpo PB and Etta SE: Effect of Trevo dietary supplement on caffeine induced oxidative stress in albino rat models. The Pharm Chem J 2016; 3: 92-97.
- Bora NS: Introduction to Melatonin: An Endogenously Synthesized Super-Compound. Acta Scientific Pharmaceutical Sciences 2019; 3: 76.
- Reiter RJ, Tan DX and Fuentes-Broto L: Melatonin: a multitasking molecule. Prog Brain Res 2010; 181: 127-51.
- Tan DX, Hardeland R, Manchester LC, Paredes SD, Korkmaz A, Sainz RM, Mayo JC, Fuentes-Broto L and Reiter RJ: The changing biological roles of melatonin during evolution: from an antioxidant to signals of darkness, sexual selection and fitness. Biol Rev CambPhilos Soc 2010; 85: 607-23.
- Puig Á, Rancana L, Paredes SD, Carrasco A, Escamesc G, Varaa E and Tresguerres JAF: Melatonin decreases the expression of inflammation and apoptosis markers in the lung of a senescence-accelerated mice model. Experimental Gerontology 2016; 75: 1-7.
- Ahmadvand H, Babaeenezhad E, Nasri M, Jafaripour L and Khorramabadi RM: Glutathione ameliorates liver markers, oxidative stress and inflammatory indices in rats with renal ischemia reperfusion injury. J Renal Inj Prev 2019; 8(2): 91-97.
- Aydemir S, Akgün SG, Beceren A, Yüksel M, Kumaş M, Erdoğa N, Sardas S and Omurtag GZ: Melatonin ameliorates oxidative DNA damage and protects against formaldehyde-induced oxidative stress in rats. Int J Clin Exp Med 2017; 10(4): 6250-61.
- Wang F, Tian X, Zhang L, Tan D, Reiter RJ and Liu G: Melatonin promotes the in-vitro development of pronuclear embryos and increases the efficiency of blastocyst implantation in murine. J Pineal Res 2013; 55: 267-74.
- Zhang JJ, Meng X, Li Y, Zhou Y, Xu DP, Li S and Li HB: Effects of Melatonin on Liver Injuries and Diseases. Int J Mol Sci 2017; 18(4): 673.
- Ibrahim MA, Eraqi MM and Alfaiz FA: Therapeutic role of taurine as antioxidant in reducing hypertension risks in rats. Heliyon 2020; 6(1): e03209.
- Jong CJ, Ito T, Prentice H, Wu JY and Schaffer SW: Role of mitochondria and endoplasmic reticulum in taurine-deficiency-mediated apoptosis. Nutrients 2017; 9(8): 795.
- Shetewy A, Shimada-Takaura K, Warner D, Jong CJ, Mehdi AB, Alexeyev M, Takahashi K and Schaffer SW: Mitochondrial defects associated with β-alanine toxicity: Relevance to hyper-beta-alaninemia. Mol Cell Biochem 2016; 416: 11-22.
- Goc Z, Kapusta E, Formicki G, Martiniaková M and Omelka R: Effect of taurine on ethanol-induced oxidative stress in mouse liver and kidney. Chin J Physiol 2019; 62: 148-56.
- Sochor J, Nejdl L, Ruttkay-Nedecky B, Bezdekova A, Lukesova K, Zitka O, Cernei N, Mares P, Pohanka M, Adam V, Babula P, Beklova M, Zeman L and Kizek R: Investigating the influence of taurine on thiol antioxidant status in Wistar rats with a multi-analytical approach. Journal of Applied Biomedicine 2014; 12: 97-110.
- Niu X, Zheng S, Liu H and Li S: Protective effects of taurine against inflammation, apoptosis, and oxidative stress in brain injury. Molecular medicine reports 2018; 18: 4516-22.
- Nicco C, Laurent A, Chereau C, Weill B and Batteux F: Differential modulation of normal and tumor cell proliferation by reactive oxygen species. Biomed Pharmacother 2005; 59: 169-74.
- Sharma V, Collins LB, Chen TH, Herr N, Takeda S, Sun W, Swenberg JA and Nakamura J: Oxidative stress at low levels can induce clustered DNA lesions leading to NHEJ mediated mutations. Oncotarget 2016; 7(18): 25377-90.
- Schmid TE, Eskenazi B, Baumgartner A, Marchetti F, Young S, Weldon R, Anderson D and Wyrobek AJ: The effects of male age on sperm DNA damage in healthy non-smokers. Human Reproduction 2007; 22: 180-87.
- Selby CP and Sancar A: Molecular mechanisms of DNA repair inhibition by caff Proc Natl Acad Sci U. S. A. 1990; 87: 3522-25.
- Reiter RJ, Tan D, Manchester LC and Qi W: Biochemical reactivity of melatonin with reactive oxygen and nitrogen species. Cell Biochem Biophys 2001; 34: 237-56.
- Leem J, Bai GY, Kim JS and Oh JS: Melatonin protects mouse oocytes from DNA damage by enhancing nonhomologous end‐joining repair. J Pineal Res 2019; 67: e12603.
- Galano A, Castañeda-Arriaga R, Pérez-González A, Tan DX and Reiter RJ: Phenolic melatonin-related compounds: Their role as chemical protectors against oxidative stress. Molecules 2016; 21(11): 1-42.
- Hacışevki A and Baba B: An overview of melatonin as an antioxidant molecule: a biochemical approach.in: melatonin-molecular biology, clinical and pharmaceutical approaches. London: Intech Open 2018.
- Abd El-Twab SM, Mohamed HM and Mahmoud AM: Taurine and pioglitazone attenuate diabetes-induced testicular damage by abrogation of oxidative stress and up-regulation of the pituitary–gonadal axis. Can J Physiol Pharmacol 2016; 94: 651-61.
- Ahmad MK, Khan AA, Ali SN and Mahmood R: Chemoprotective effect of taurine on potassium bromate-induced DNA damage, DNA-protein cross-linking and oxidative stress in rat intestine. PloS one 2015; 10(3): e0119137.
- Winston AP, Hardwick E and Jaberi N: Neuropsychiatric effects of caffeine. Advances in Psychiatric Treatment 2005; 11: 432-39.
- Ohta A, Lukashev D, Jackson EK, Fredholm BB and Sitkovsky M: 1,3,7-trimethylxanthine (Caffeine) may exacerbate acute inflammatory liver injury by weakening the physiological immunosuppressive mechanism. J Immunol 2007; 179(11): 7431-38.
- Olatunji SY, Owolabi JO and Olanrewaju AJ: Excessive Caffeine consumption altered cerebral cortex histoarchitecture and cell morphologies in adult mice. Anatomy Journal of Africa 2017; 6(1): 856-61.
- Volkow ND, Wang GJ, Logan J, Alexoff D, Fowler JS, Thanos PK, Wong C, Casado V, Ferre S and Tomasi D: Caffeine increases striatal dopamine D2/D3 receptor availability in the human brain. Transl Psych 2015; 5: 549.
- Smith A, Brice C, Nash J, Rich N and Nutt DJ: Caffeine and central noradrenaline: effects on mood, cognitive performance, eye movements and cardiovascular function. Journal of Psychopharmacology 2003; 17: 283-92.
- Ferre S, Fuxe K, von Euler G, Johansson B and Fredholm BB: Adenosine– dopamine interactions in the brain. Neuroscience 1992; 51: 501-12.
- Laudon M and Zisapel N: Characterization of central melatonin receptors using 125I-melatonin. FEBS Lett. 1986; 197: 9-12.
- Barbosa-Méndez S and Salazar-Jua´rez A: Melatonin decreases cocaine-induced locomotor activity in pinealectomized rats. Braz J Psychiatry 2020.
- Stefanovic B, Spasojevic N, Jovanovic P and Dronjak S: Melatonin treatment affects changes in adrenal gene expression of catecholamine biosynthesizing enzymesand norepinephrine transporter in the rat model of chronic stress-induced depression. Can J Physiol Pharmacol 2019; 97(7): 685-90.
- Saransaari P and Oja SS: Taurine in neurotransmission. In Handbook of Neurochemistry and Molecular Neurobiology, 3rd edn, Neurotransmitter Systems, E. S. Vizi (ed.) 2008; 2: 325-42
- Ruotsalainen M, Heikkilä M, Lillsunde P, Seppälä T and Ahtee L: Taurine infused intrastriatally elevates, but intra-nigrally decreases striatal extracellular dopamine concen-tration in anaesthetized rats. JNT 1996; 103: 935-46.
- Kontro P and Oja SS: Release of taurine, GABA and dopamine from rat striatal slices: mutual interactions and developmental aspects. Neuroscience 1998; 24: 49-58.
- Ruotsalainen M and Ahtee L: Intrastriatal taurine increases striatal extracellular dopamine in a tetrodotoxin-sensitive manner in rats. Neurosci Lett 1996; 212: 175-78.
- Chen VC, Chiu CC, Chen LJ, Hsu TC and Tzang BS: Effects of taurine on striatal dopamine transporter expression and dopamine uptake in SHR rats. Behav Brain Res 2018; 348: 219-26.
- Kontro P, Korpi ER, Oja OS and Oja SS: Modulation of noradrenaline uptake and release by taurine in rat cerebral slices. Neuroscience 1984; 13: 663-66.
- Jakaria M, Azam S, Haque ME, Jo SH, Uddin MS, Kim IS and Choi DK: Taurine and its analogs in neurological disorders: Focus on therapeutic potential and molecular mechanisms. Redox Biol 2019; 24: 101223.
- Redza-Dutordoir M and Averill-Bates DA: Activation of apoptosis signalling pathways by reactive oxygen species. Biochimica et Biophysica Acta 2016; 1863: 2977-92.
- Liao Z, Chua D and Tan NS: Reactive oxygen species: a volatile driver of field cancerization and metastasis. Mol Cancer 2019; 18: 65.
- Wang Q, Zhang L, Yuan X, Ou Y, Zhu X, Cheng Z, Zhang P, Wu X, Meng Y and Zhang L: The Relationship between the Bcl-2/Bax Proteins and the Mitochondria-Mediated Apoptosis Pathway in the Differentiation of Adipose-Derived Stromal Cells into Neurons. PLoS One 2016; 11(10): e0163327.
- Lu GY, Huang SM, Liu ST, Liu PY, Chou WY and Lin WS: Caffeine induces tumor cytotoxicity via the regulation of alternative splicing in subsets of cancer-associated genes. Int J Biochem Cell Biol 2014; 47: 83-92.
- Lee JG, Woo YS, Park SW, Seog DH, Seo MK and Bahk WM: The Neuroprotective Effects of Melatonin: Possible Role in the Pathophysiology of Neuropsychiatric Disease Brain Sci 2019; 9(10): 285.
- Juknat AA, Mendez M del V, Quaglino A, Fameli CI, Mena M and Kotler ML: Melatonin prevents hydrogen peroxide-inducedBax expression in cultured rat astrocytes. J Pineal Res 2005; 38: 84-92.
- Xu G, Zhao J, Liu H, Wang J and Lu W: Melatonin Inhibits Apoptosis and Oxidative Stress of Mouse Leydig Cells via a SIRT1-Dependent Mechanism. Molecules 2019; 24(17): 3084.
- Ramis MR, Esteban S, Miralles A, Tan DX and Reiter RJ: Protective effects of melatonin and mitochondria-targeted antioxidants against oxidative stress: a review. Curr Med Chem 2015; 22(22): 2690-711.
- Colunga-Biancatelli RML, Berrill M, Mohammed YH and Marik PE: Melatonin for the treatment of sepsis: the scientific rationale. J Thorac Dis 2020; 12: S54-S65.
- Lang F, Madlung J, Siemen D, Ellory C, Lepple-Wienhues A and Gulbins E: The involvement of caspases in CD95 (Fas/Apo1) but not swelling-induced cellular taurine release from Jurkat T-lymphocytes. Pflügers Arch 2000; 440: 93-99.
- Yang X, Fu J, Wan H, Liu Z, Yu L, Yu B and Wan F: Protective roles and mechanisms of taurine on mycocardial hypoxia-reoxygenatation-induced apoptosis. Acta Cardiol Sin 2019; 35(4): 415-24.
How to cite this article:
Sayed RA, Khadrawy SM, Mohamed HM and Aly MS: Protective role of melatonin and taurine against toxicity induced by caffeine in brain by abrogation of oxidative stress, decrease apoptosis, and alters cerebral monoamine neurotransmitters in male albino rats. Int J Pharm Sci & Res 2021; 12(1): 136-48. doi: 10.13040/IJPSR.0975-8232.12(1).136-48.
All © 2013 are reserved by the International Journal of Pharmaceutical Sciences and Research. This Journal licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.
Article Information
13
136-148
1210
1969
English
IJPSR
R. A. Sayed, S. M. Khadrawy, H. M. Mohamed and M. S. Aly *
Genetics Branch, Department of Zoology, Faculty of Science, Beni-Suef University, Beni-Suef, Egypt.
dr.magdy@science.bsu.edu.eg
26 December 2019
08 April 2020
25 June 2020
10.13040/IJPSR.0975-8232.12(1).136-48
01 January 2021









